- Transcript 'Mooccu.CG.ELv1_2.S71...' >
- Region 'REG00000216' >
- Transcript 'Haaura.CG.MTP2014.S4...' >
- Transcript 'Phmamm.CG.MTP2014.S7...' >
- Region 'REG00000697'
Cis-regulatory Region
Name
Ci-Pitx -2751/-2696 repeated x2 Second Otx site mutated
Short name
n/a
Region ID
REG00000697
Status
Curated
Origin
engineered region from C. robusta formely Ciona int. type A
Type of Activity
inactive_region
Author
Maximilian Haeussler (2010-06-04)
Annotator
Clara Degos (2010-07-22)
Curator
Delphine Dauga (2011-08-10)
Minimal enhancer upstream of Pitx gene from -2751 to -2696, called D1(ab)(ab-Omut) in the paper. The region named D1ab in the paper was repeat 2 times and the Otx site in the repeated region was mutated. This region can t drive expression in the neurohypophysis primordium.
KH transcript model was taken as reference for the region s coordinates.
Modification of Ci-Pitx -2751/-2696 repeated x2 by deletion
- Ci-Pitx -7865/140 REG00000681 [ regulatory_region (extended_promoter) ]
- Ci-Pitx -2735/-2540 REG00000682 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 First Otx site mutated REG00000685 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 Second Otx site mutated REG00000686 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 First Forkhead site mutated REG00000687 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 Second Forkhead site mutated REG00000688 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 First Smad site mutated REG00000689 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 Second, Third, Fourth Smad site mutated REG00000690 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 TALE-class sites mutated REG00000691 [ regulatory_region (enhancer) ]
- Ci-Pitx -2751/-2543 delta -2693/-2646 delta -2606/-2588 REG00000684 [ regulatory_region (complex_region) ]
- Ci-Pitx -2751/-2606 delta -2693/-2646 REG00000692 [ inactive_region ]
- Ci-Pitx -2751/-2696 REG00000693 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2 REG00000694 [ regulatory_region (complex_region) ]
- Ci-Pitx -2751/-2696 repeated x2 Second Pax site deleted REG00000696 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2 Second Otx site mutated REG00000697 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2 Second Forkhead site mutated REG00000698 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2 Second Smad site mutated REG00000699 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2/25bp spacer REG00000700 [ regulatory_region (complex_region) ]
- Ci-Pitx -2751/-2696 repeated x2/50bp spacer REG00000701 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2/75bp spacer REG00000702 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x2/150bp spacer REG00000703 [ inactive_region ]
- Ci-Pitx -2751/-2696 repeated x5 REG00000695 [ regulatory_region (complex_region) ]
- Ci-Pitx -2751/-2606 delta -2693/-2646 REG00000692 [ inactive_region ]
- Ci-Pitx -5500/56 REG00000874 [ regulatory_region (extended_promoter) ]
- Ci-Pitx -5500/-1328 REG00000875 [ regulatory_region (complex_region) ]
- Ci-Pitx -2751/-2540 REG00000873 [ regulatory_region (enhancer) ]
- REG00000876 [ regulatory_region (complex_region) ]
- REG00000877 [ regulatory_region (complex_region) ]
- Ci-Pitx -3815/55 REG00000878 [ regulatory_region (extended_promoter) ]
- Ci-Pitx -3164/56 REG00000879 [ regulatory_region (extended_promoter) ]
- Ci-Pitx -3429/-2250 REG00000888 [ regulatory_region (complex_region) ]
- Ci-Pitx -5500/-1328 REG00000875 [ regulatory_region (complex_region) ]
- Ci-Pitx -2760/140 REG00000885 [ regulatory_region (extended_promoter) ]
- Ci-Pitx -3853/147 REG00000891 [ regulatory_region (extended_promoter) ]
- Ci-Pitx -3853/-553 REG00000892 [ regulatory_region (enhancer) ]
- Ci-Pitx -553/147 REG00000893 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KhL153:204692-208149|Pitx REG00001523 [ regulatory_region (enhancer) ]
- Ci-Pitx -2735/-2540 REG00000682 [ regulatory_region (enhancer) ]
CONS00000666: pCi-Pitx -2751/-2696 repeated x2 Second Otx site mutated:CES2:LacZ
197,501197,555
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | Paired | n/a | CGCGACGA | [-2,748 / -2,741] | |
2 | Homeobox | n/a | GATTA | [-2,732 / -2,728] | |
3 | Fox | n/a | TAATATTTCTTT | [-2,724 / -2,713] | |
4 | MAD | n/a | GCCG | [-2,705 / -2,702] | |
5 | Paired | n/a | CGCGACGA | [-2,693 / -2,686] | |
6 | Fox | n/a | TAATATTTCTTT | [-2,669 / -2,658] | |
7 | MAD | n/a | GCCG | [-2,650 / -2,647] |
Aniseed Coordinates: [197,501 / 197,555] on scaffold KhL153
The second Otx site was mutated (GATTA=>GATGA).
The sequence is based on the first codon on the KH transcript.
AAACGCGACGACCTCCACGGATTAAGGTAATATTTCTTTTTATGTTGCCGCCCAGAAACG
CGACGACCTCCACGGATGAAGGTAATATTTCTTTTTATGTTGCCGCCCAG