- Clone 'cien198296' >
- EST 'AV678118' >
- Clone 'cien59428' >
- Region 'REG00000798'
Cis-regulatory Region
Name
Ci-Nut1 -123/94 ZicL2 mutated 2
Short name
n/a
Region ID
REG00000798
Status
Curated
Origin
engineered region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(extended_promoter)
Author
Kotaro Shimai (2010-06-30)
Annotator
Clara Degos (2011-08-11)
Curator
Delphine Dauga (2011-08-11)
Region upstream of Ci-Nut1 from -123bp to +94bp. This region is the minimal region driving neural tube expression.
Three putative regulatory motifs were present in this region : 2 ZicL binding sites and one Fox binding site. Here the second ZicL binding site was mutated GTCGCTTTG => GCCTATTTG three times. This region was named ZicL2(m245), and can drive expression in neural tube even if the expression was reduced due to the mutations.
Transcription start site is based on the start of the first exon of the KH transcript model.
Be carefull the coordinates in the paper may be different from ANISEED coordinates.
Modification of Ci-Nut1 -123/94 by substitution
- Ci-Nut1 -1119/94 REG00000776 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -1118/38 REG00000558 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -1030/94 REG00000777 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -927/94 REG00000778 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -824/94 REG00000779 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -733/94 REG00000780 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -617/94 REG00000781 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -530/94 REG00000782 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -426/94 REG00000783 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -318/94 REG00000784 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -235/94 REG00000785 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -123/94 REG00000786 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -77/94 REG00000787 [ regulatory_region (enhancer) ]
- Ci-Nut1 -123/94 ZicL1 mutated 1 REG00000789 [ inactive_region ]
- Ci-Nut1 -123/94 ZicL1 mutated 2 REG00000790 [ inactive_region ]
- Ci-Nut1 -123/94 ZicL1 mutated 3 REG00000791 [ inactive_region ]
- Ci-Nut1 -123/94 ZicL1 mutated 4 REG00000792 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -123/94 Fox mutated 1 REG00000793 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -123/94 Fox mutated 2 REG00000794 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -123/94 Fox mutated 3 REG00000795 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -123/94 Fox mutated 4 REG00000796 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -123/94 ZicL2 mutated 1 REG00000797 [ inactive_region ]
- Ci-Nut1 -123/94 ZicL2 mutated 2 REG00000798 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -123/94 ZicL2 mutated 3 REG00000799 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -123/94 ZicL2 mutated 4 REG00000800 [ regulatory_region (extended_promoter) ]
- REG00000804 [ regulatory_region (complex_region) ]
- REG00000805 [ regulatory_region (complex_region) ]
- REG00000806 [ regulatory_region (complex_region) ]
- REG00000807 [ regulatory_region (complex_region) ]
- REG00000808 [ regulatory_region (complex_region) ]
- REG00000809 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -123/94 REG00000786 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -235/94 REG00000785 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -318/94 REG00000784 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -426/94 REG00000783 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -530/94 REG00000782 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -617/94 REG00000781 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -733/94 REG00000780 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -824/94 REG00000779 [ regulatory_region (extended_promoter) ]
- Ci-Nut1 -927/94 REG00000778 [ regulatory_region (extended_promoter) ]
1,413,7951,414,011
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | ZnF_(C2H2) | n/a | CATGCTGTG | [-74 / -66] | |
2 | Fox | n/a | TGTATTGTTT | [-63 / -54] |
Aniseed Coordinates: [1,413,795 / 1,414,011] on scaffold KhC14
Transcription start site is based on the start of the first exon of the KH transcript model.
TTCACTGCGTTGTCTAAATCCATGCGAAACAACAAAATAAGTCGCAAGACATGCTGTGCG
TGTATTGTTTTTTTGAAACCCCGCCTATTTGTGAAAATCTGGTTGATTATTTTTTCGTAC
CAGTTTTACAGTTTAAATACGACTGTGCTTCAGTTTTTGTTAGTATTGAGTTGTACACTA
TATCAACAACATGGAAATTGATTTTGGATTTGCAAGA