Login
Help

Submit your Data

  1. Region 'REG00001247'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.C9:5648367-5648505|DDR1; DDR2; MUSK

Short name

DDR1/2_CRM24_139pb

Region ID

REG00001247

Status

Curated

Origin

natural region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2017-09-09)

Annotator

Marion Gueroult-Bellone (2017-09-09)

Curator

Marion Gueroult-Bellone (2018-05-09)


Description

This 139pb sequence, located upstream of DDR1/DDR2/MUSK (KH.C9.371), drives reporter gene expression in notochord, head epidermis and tail muscles. It contains a cluster of Fox and Brachyury putative binding sites and can be considered as a minimal enhancer.

Regulated gene(s)

KH2012:KH.C9.371 (DDR1; DDR2)

Overview of functional TF binding sites in this region

5,648,3675,648,505

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 T-Box n/a tctcac [5,648,369 / 5,648,375] First Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer.
2 T-Box n/a gtgaca [5,648,387 / 5,648,393] Second Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of all four Brachyury sites strongly reduces enhancer activity in the notochord.
3 T-Box n/a gtgtga [5,648,400 / 5,648,406] Third Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of all four Brachyury sites strongly reduces enhancer activity in the notochord.
4 Fox n/a tatttac [5,648,424 / 5,648,431] First Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of this site alone does not affect enhancer activity in the notochord, but creates new activity in central nervous system and tail muscle. Mutation of this site and of the fourth Brachyury site strongly reduces enhancer activity in the notochord. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
5 T-Box n/a gtgtaa [5,648,439 / 5,648,445] Fourth Brachyury binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of this site alone does not affect enhancer activity in the notochord, but creates new mesenchyme activity. Mutation of this site and of the first Fox site strongly reduces enhancer activity in the notochord. Mutation of all four Brachyury sites strongly reduces enhancer activity in the notochord.
6 Fox n/a gtaaata [5,648,441 / 5,648,448] Second Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
7 Fox n/a ataaaca [5,648,445 / 5,648,452] Third Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
8 Fox n/a acaaata [5,648,449 / 5,648,456] Fourth Fox binding site of the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer. Mutation of the three other three Fox sites and of the fourth Brachyury site abolishes enhancer activity in the notochord.
9 Helix Turn Helix / Tryptophane clusters n/a attgaa [5,648,477 / 5,648,483] This Myb#2 binding site is located in the notochord-active enhancer of KH.C9.371.
10 ZnF_(C2H2) n/a ccacc [5,648,492 / 5,648,497] Sp1/Klf binding site located next to the Brachyury/Fox sites cluster contained in DDR1/2 139pb enhancer.

Sequence

Aniseed Coordinates: [5,648,367 / 5,648,505] on scaffold KhC9

This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS2.a and TableS5 of Jose-Edwards et al. 2015.

Show sequence

Length: 139


aatctcacttacttgcgaaggtgacatcacccggtgtgacggatctcaaaccaggtttat
ttact
tcctcgtgtgtaaataaacaaatacagatcgcaaggctttgtcatattgaactct
gaaagccaccgctgttgcg





By clicking "SEND", you accept the terms of our Privacy Policy.

You may choose to prevent this website from aggregating and analyzing the actions you take here. Doing so will protect your privacy, but will also prevent the owner from learning from your actions and creating a better experience for you and other users.