- Region 'REG00001283'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.C7:3853910-3854222_Bra2Fox2mut|Ephrin3
Short name
Ephrin3_CRM66_313pb_Bra2/Fox2mut
Region ID
REG00001283
Status
Curated
Origin
engineered region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
This 313pb sequence, located in an intronic region of Ephrin3 (KH.C7.568), drives reporter gene expression in notochord, mesenchyme and head epidermis. It contains 2 Myb #2, 1 E-box, 1 Sp1/Kif, 2 Brachyury and 3 Fox putative binding sites and one AC repeat (six repeats). Second Brachyury and seconf Fox putative binding sites were mutated : TCACAC replaced by TCAaga and TGTTTAT replaced by TGggccg respectively
Modification of Cirobu.REG.KH2012.C7:3853910-3854222|Ephrin3 by substitution
- Cirobu.REG.KH2012.C7:3853138-3854780|Ephrin3 REG00001277 [ regulatory_region (complex_region) ]
- Cirobu.REG.KH2012.C7:3853138-3853945|Ephrin3 REG00001278 [ no_output ]
- Cirobu.REG.KH2012.C7:3853910-3854222|Ephrin3 REG00001279 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853910-3854157|Ephrin3 REG00001280 [ no_output ]
- Cirobu.REG.KH2012.C7:3853970-3854222|Ephrin3 REG00001281 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854157|Ephrin3 REG00001282 [ no_output ]
- Cirobu.REG.KH2012.C7:3853970-3854222_Bra2mut|Ephrin3 REG00001284 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_FSM1|Ephrin3 REG00001376 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_LSM2|Ephrin3 REG00001377 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_LSM3|Ephrin3 REG00001378 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_LSM4|Ephrin3 REG00001379 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_LSM5|Ephrin3 REG00001380 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_LSM6|Ephrin3 REG00001381 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_LSM7|Ephrin3 REG00001382 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_(AC)2mut|Ephrin3 REG00001383 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_(AC)6mut|Ephrin3 REG00001384 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853910-3854222_Bra2Fox2mut|Ephrin3 REG00001283 [ regulatory_region (enhancer) ]
CONS00001302: p.Cirobu.REG.KH2012.C7:3853910-3854222_Bra2Fox2mut>LacZ
3,853,9103,854,222
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | Helix Turn Helix / Tryptophane clusters | n/a | attgaa | [3,853,923 / 3,853,929] | This is one of the two Myb#2 binding sites located in the notochord-active enhancer of KH.C7.568. Deletion of the region containing these two binding sites does not affect the enhancer activity in the notochord. |
2 | Helix Turn Helix / Tryptophane clusters | n/a | attgaa | [3,853,942 / 3,853,948] | This is one of the two Myb#2 binding sites located in the notochord-active enhancer of KH.C7.568. Deletion of the region containing these two binding sites does not affect the enhancer activity in the notochord. |
3 | Fox | n/a | tatttat | [3,853,959 / 3,853,966] | This Fox binding site is one of the 3 putative binding sites located in the 313pb enhancer of Ephrin3 (KH.C7.568). |
4 | ZnF_(C2H2) | n/a | ccacc | [3,853,992 / 3,853,997] | This Sp1/Klf binding site is located in the intronic enhancer of Ephrin3 (KH.C7.568). |
5 | T-Box | n/a | tcacac | [3,854,037 / 3,854,043] | This Brachyury binding site is located in the intronic enhancer of Ephrin3 (KH.C7.568). |
6 | Fox | n/a | tatttgt | [3,854,049 / 3,854,056] | This Fox binding site is located in the intronic enhancer of Ephrin3 (KH.C7.568). |
7 | bHLH | n/a | cagatg | [3,854,195 / 3,854,201] | This E-box binding site is located in the intronic enhancer of Ephrin3 (KH.C7.568). |
Aniseed Coordinates: [3,853,910 / 3,854,222] on scaffold KhC7
Sequence of the primers used : Forward : CAATCTAGGTCAagaACACACACAC Reverse 1: GTGTGTGTGTtctTGACCTAGATTG Reverse 2 : GAccatggCAATACTACAATGgggcgATTACATCTG Lowercase letters correspond to XhoI/XbaI restriction site in Forward and Reverse 1, and they correspond to subsitutions in Reverse 2 (mutation of Bra and Fox putative binding sites). This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS3.a and TableS5 of Jose-Edwards et al. 2015.
gaaatctaaatgtattgaacggtaaacgtcgtattgaaaaatgaatctctatttataact
ctctacagtatacggagagtccccacccattaaacaaacgtaatattaattgttagatag
atatgattcacacaggatgtatttgtggtgtctggattaacccccagtaagaattctctg
ccatacaatagcagcgtgtttgaattactgcttgttttggcaagttgattaagtcaggtc
aatctaggtcaAGAacacacacacactgtatgtatatacacaacacagatgtaatCGGCC
cattgtagtattg