Login
Help

Submit your Data

  1. Region 'REG00001283'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.C7:3853910-3854222_Bra2Fox2mut|Ephrin3

Short name

Ephrin3_CRM66_313pb_Bra2/Fox2mut

Region ID

REG00001283

Status

Curated

Origin

engineered region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2018-02-27)

Annotator

Marion Gueroult-Bellone (2018-02-27)


Description

This 313pb sequence, located in an intronic region of Ephrin3 (KH.C7.568), drives reporter gene expression in notochord, mesenchyme and head epidermis. It contains 2 Myb #2, 1 E-box, 1 Sp1/Kif, 2 Brachyury and 3 Fox putative binding sites and one AC repeat (six repeats). Second Brachyury and seconf Fox putative binding sites were mutated : TCACAC replaced by TCAaga and TGTTTAT replaced by TGggccg respectively

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KH2012.C7:3853910-3854222|Ephrin3 by substitution

Overview of functional TF binding sites in this region

3,853,9103,854,222

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 Helix Turn Helix / Tryptophane clusters n/a attgaa [3,853,923 / 3,853,929] This is one of the two Myb#2 binding sites located in the notochord-active enhancer of KH.C7.568. Deletion of the region containing these two binding sites does not affect the enhancer activity in the notochord.
2 Helix Turn Helix / Tryptophane clusters n/a attgaa [3,853,942 / 3,853,948] This is one of the two Myb#2 binding sites located in the notochord-active enhancer of KH.C7.568. Deletion of the region containing these two binding sites does not affect the enhancer activity in the notochord.
3 Fox n/a tatttat [3,853,959 / 3,853,966] This Fox binding site is one of the 3 putative binding sites located in the 313pb enhancer of Ephrin3 (KH.C7.568).
4 ZnF_(C2H2) n/a ccacc [3,853,992 / 3,853,997] This Sp1/Klf binding site is located in the intronic enhancer of Ephrin3 (KH.C7.568).
5 T-Box n/a tcacac [3,854,037 / 3,854,043] This Brachyury binding site is located in the intronic enhancer of Ephrin3 (KH.C7.568).
6 Fox n/a tatttgt [3,854,049 / 3,854,056] This Fox binding site is located in the intronic enhancer of Ephrin3 (KH.C7.568).
7 bHLH n/a cagatg [3,854,195 / 3,854,201] This E-box binding site is located in the intronic enhancer of Ephrin3 (KH.C7.568).

Sequence

Aniseed Coordinates: [3,853,910 / 3,854,222] on scaffold KhC7

Sequence of the primers used : Forward : CAATCTAGGTCAagaACACACACAC Reverse 1: GTGTGTGTGTtctTGACCTAGATTG Reverse 2 : GAccatggCAATACTACAATGgggcgATTACATCTG Lowercase letters correspond to XhoI/XbaI restriction site in Forward and Reverse 1, and they correspond to subsitutions in Reverse 2 (mutation of Bra and Fox putative binding sites). This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS3.a and TableS5 of Jose-Edwards et al. 2015.

Show sequence

Length: 313


gaaatctaaatgtattgaacggtaaacgtcgtattgaaaaatgaatctctatttataact
ctctacagtatacggagagtccccacccattaaacaaacgtaatattaattgttagatag
atatgattcacacaggatgtatttgtggtgtctggattaacccccagtaagaattctctg
ccatacaatagcagcgtgtttgaattactgcttgttttggcaagttgattaagtcaggtc
aatctaggtcaAGAacacacacacactgtatgtatatacacaacacagatgtaatCGGCC
cattgtagtattg





By clicking "SEND", you accept the terms of our Privacy Policy.

You may choose to prevent this website from aggregating and analyzing the actions you take here. Doing so will protect your privacy, but will also prevent the owner from learning from your actions and creating a better experience for you and other users.