Login
Help

CIS-REGULATION

Submit your Data

  1. Transcript 'KH2012:KH.C2.4.v3.A....' > 
  2. Clone 'cien76417' > 
  3. Region 'REG00001363' > 
  4. Region 'REG00001316' > 
  5. Region 'REG00001341'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.C5:4471567-4472163|Rfx1/2/3

Short name

n/a

Region ID

REG00001341

Status

Curated

Origin

natural region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(complex_region)

Author

Diana S. José-Edwards (2018-05-08)

Annotator

Marion Gueroult-Bellone (2018-05-08)

Curator

Marion Gueroult-Bellone (2018-05-08)

View position in WashU

Description

Hierarchy of Regulatory Regions

Regulated gene(s)

KH2012:KH.C5.399 (RFX1; RFX2; RFX3)

Construct(s) made to test this region

CONS00001361: p.Cirobu.REG.KH2012.C5:4471567-4472163>LacZ

Show in situ data
Overview of functional TF binding sites in this region

4,471,5674,472,163

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 Helix Turn Helix / Tryptophane clusters n/a gtta [4,471,870 / 4,471,874] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399.
2 Helix Turn Helix / Tryptophane clusters n/a gtta [4,471,875 / 4,471,879] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399.
3 Helix Turn Helix / Tryptophane clusters n/a taac [4,471,912 / 4,471,916] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399.
4 bHLH n/a catttg [4,471,920 / 4,471,926] This is one of the 2 E-box binding sites located in the notochord-active enhancer of KH.C5.399.
5 Fox n/a tgtttac [4,471,981 / 4,471,988] This is one of the 2 Fox binding sites located in the notochord-active enhancer of KH.C5.399.
6 Helix Turn Helix / Tryptophane clusters n/a attgaa [4,472,025 / 4,472,031] This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#2 binding site does not affect the enhancer activity in the notochord.
7 Helix Turn Helix / Tryptophane clusters n/a attgaa [4,472,025 / 4,472,031] This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#2 binding site does not affect the enhancer activity in the notochord.
8 T-Box n/a gtgtta [4,472,035 / 4,472,041] This Brachyury binding site is located in the notochord-active enhancer of KH.C5.399. Mutation of this Brachyury binding site does not affect the enhancer activity in the notochord.
9 Helix Turn Helix / Tryptophane clusters n/a taac [4,472,039 / 4,472,043] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#1 binding site does not affect the enhancer activity in the notochord.
10 Helix Turn Helix / Tryptophane clusters n/a taac [4,472,044 / 4,472,048] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#1 binding site alone does not affect the enhancer activity in the notochord. Mutation of both this binding site and the neighbouring Myb#2 binding site inhibits enhancer activity in the notochord.
11 Helix Turn Helix / Tryptophane clusters n/a attgaa [4,472,052 / 4,472,058] This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#2 binding site alone does not affect the enhancer activity in the notochord. Mutation of both this binding site and the neighbouring Myb#1 binding site inhibits enhancer activity in the notochord.
12 bHLH n/a caaatg [4,472,076 / 4,472,082] This is one of the 2 E-box binding sites located in the notochord-active enhancer of KH.C5.399.
13 Fox n/a tgtttgt [4,472,101 / 4,472,108] This is one of the 2 Fox binding sites located in the notochord-active enhancer of KH.C5.399.
14 Helix Turn Helix / Tryptophane clusters n/a ttcaat [4,472,129 / 4,472,135] This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399.
15 Helix Turn Helix / Tryptophane clusters n/a ccgttg [4,472,145 / 4,472,151] This Myb#3 binding site is located in the notochord-active enhancer of KH.C5.399. Its mutation does not affect the enhancer activity in the notochord.

Sequence

Aniseed Coordinates: [4,471,567 / 4,472,163] on scaffold KhC5

This 682bp sequence, located in the downstream region of KH.C5.399, drives reporter gene expression in notochord. It contains 5 Myb#1, 2 E-box, 2 Fox, 3 Myb#2, 1 Brachyury and 1 Myb#3 putative binding sites. This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS1.d and TableS5 of Jose-Edwards et al. 2015.

Show sequence

Length: 597


tggcagtctcatacattctaatctggaatagcgagttctgaatattgtattgtgtattct
acagcagtggtggtgagatttaaagagatttttaagcagttctataatgtttaaatgaga
atactttgtaagcaaaccattcataacaacttctattatattgagttaaattgccaggta
tgtctaaattcaacagcttcggtaatggcgcattctttgtcataattatacggaggcagg
ctggtgtacgaagaaattccatttcgacacgacatgttgcgctgtagtgactcaagtttc
aaagttatgttaagctttaagaaaagtgtagacaggcgtactgcttaacaaaacatttgc
agactattaaaaattatttaaagtattaataagcgctactttaatatttttgtatgttta
ccagtaatgagtttcgtacagaatacgttgcgccgtgaattgaaatgtgtgttaacttaa
cctagattgaatgcattccgtctcgagtacaaatgcctttctgatttgttgtcttgtttg
ttttgcgtctctctcgctcttgttcaatatttagaaagccgttgtgactatgctgtg

Reference(s)

José-Edwards et al. (2015). Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord. PLoS Genet. 11(12):e1005730

Back to Top