Login
Help

Submit your Data

  1. Clone 'citb1g23'
  2. Region 'REG00001342'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.C5:4471738-4472163|Rfx1/2/3

Short name

n/a

Region ID

REG00001342

Status

Curated

Origin

natural region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2018-05-08)

Annotator

Marion Gueroult-Bellone (2018-05-08)

Curator

Marion Gueroult-Bellone (2018-05-08)


Description

This 89bp sequence, located in the downstream region of KH.C5.399, drives reporter gene expression in notochord, msenchyme, tail muscles and head epidermis. It contains 5 Myb#1, 2 E-box, 2 Fox, 3 Myb#2, 1 Brachyury and 1 Myb#3 putative binding sites.

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KH2012.C5:4471567-4472163|Rfx1/2/3 by deletion

Overview of functional TF binding sites in this region

4,471,7384,472,163

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 Helix Turn Helix / Tryptophane clusters n/a gtta [4,471,870 / 4,471,874] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399.
2 Helix Turn Helix / Tryptophane clusters n/a gtta [4,471,875 / 4,471,879] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399.
3 Helix Turn Helix / Tryptophane clusters n/a taac [4,471,912 / 4,471,916] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399.
4 bHLH n/a catttg [4,471,920 / 4,471,926] This is one of the 2 E-box binding sites located in the notochord-active enhancer of KH.C5.399.
5 Fox n/a tgtttac [4,471,981 / 4,471,988] This is one of the 2 Fox binding sites located in the notochord-active enhancer of KH.C5.399.
6 Helix Turn Helix / Tryptophane clusters n/a gtgtta [4,472,035 / 4,472,041] This Brachyury binding site is located in the notochord-active enhancer of KH.C5.399. Mutation of this Brachyury binding site does not affect the enhancer activity in the notochord.
7 Helix Turn Helix / Tryptophane clusters n/a taac [4,472,039 / 4,472,043] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#1 binding site does not affect the enhancer activity in the notochord.
8 Helix Turn Helix / Tryptophane clusters n/a taac [4,472,044 / 4,472,048] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#1 binding site alone does not affect the enhancer activity in the notochord. Mutation of both this binding site and the neighbouring Myb#2 binding site inhibits enhancer activity in the notochord.
9 Helix Turn Helix / Tryptophane clusters n/a attgaa [4,472,052 / 4,472,058] This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#2 binding site alone does not affect the enhancer activity in the notochord. Mutation of both this binding site and the neighbouring Myb#1 binding site inhibits enhancer activity in the notochord.
10 bHLH n/a caaatg [4,472,076 / 4,472,082] This is one of the 2 E-box binding sites located in the notochord-active enhancer of KH.C5.399.
11 Fox n/a tgtttgt [4,472,101 / 4,472,108] This is one of the 2 Fox binding sites located in the notochord-active enhancer of KH.C5.399.
12 Helix Turn Helix / Tryptophane clusters n/a ttcaat [4,472,129 / 4,472,135] This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399.
13 Helix Turn Helix / Tryptophane clusters n/a ccgttg [4,472,145 / 4,472,151] This Myb#3 binding site is located in the notochord-active enhancer of KH.C5.399. Its mutation does not affect the enhancer activity in the notochord.

Sequence

Aniseed Coordinates: [4,471,738 / 4,472,163] on scaffold KhC5

This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS1.d and TableS5 of Jose-Edwards et al. 2015.

Show sequence

Length: 426


tgccaggtatgtctaaattcaacagcttcggtaatggcgcattctttgtcataattatac
ggaggcaggctggtgtacgaagaaattccatttcgacacgacatgttgcgctgtagtgac
tcaagtttcaaagttatgttaagctttaagaaaagtgtagacaggcgtactgcttaacaa
aacatttgcagactattaaaaattatttaaagtattaataagcgctactttaatattttt
gtatgtttaccagtaatgagtttcgtacagaatacgttgcgccgtgaattgaaatgtgtg
ttaa
cttaacctagattgaatgcattccgtctcgagtacaaatgcctttctgatttgttg
tcttgtttgttttgcgtctctctcgctcttgttcaatatttagaaagccgttgtgactat
gctgtg





By clicking "SEND", you accept the terms of our Privacy Policy.