- Region 'REG00001345'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5Mut_Myb2-2Mut|Rfx1/2/3
Short name
n/a
Region ID
REG00001345
Status
Curated
Origin
engineered region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2018-05-08)
Annotator
Marion Gueroult-Bellone (2018-05-08)
Curator
Marion Gueroult-Bellone (2018-05-08)
This 89bp sequence, located in the downstream region of KH.C5.399, drives reporter gene expression in mesenchyme, head epidermis and central nervous system, but not in notochord. It contains 4 Myb#1, 2 E-box, 2 Fox, 2 Myb#2, 1 Brachyury and 1 Myb#3 putative binding sites. Compared to the notochord-active WT enhancer, it lacks the second Myb#2 and the 5th Myb#1 binding sites.
Modification of Cirobu.REG.KH2012.C5:4471738-4472163|Rfx1/2/3 by deletion
- Cirobu.REG.KH2012.C5:4471567-4472163|Rfx1/2/3 REG00001341 [ regulatory_region (complex_region) ]
- Cirobu.REG.KH2012.C5:4471738-4472163|Rfx1/2/3 REG00001342 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5Mut|Rfx1/2/3 REG00001343 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb2-2Mut|Rfx1/2/3 REG00001344 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5Mut_Myb2-2Mut|Rfx1/2/3 REG00001345 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471851-4472163|Rfx1/2/3 REG00001346 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb2-2orientationReversed|Rfx1/2/3 REG00001385 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5/Myb2-2exchange|Rfx1/2/3 REG00001386 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_insertion|Rfx1/2/3 REG00001387 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163|Rfx1/2/3 REG00001342 [ regulatory_region (enhancer) ]
CONS00001365: p.Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5Mut_Myb2-2Mut>LacZ
4,471,7384,472,163
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | Helix Turn Helix / Tryptophane clusters | n/a | gtta | [4,471,870 / 4,471,874] | This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. |
2 | Helix Turn Helix / Tryptophane clusters | n/a | gtta | [4,471,875 / 4,471,879] | This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. |
3 | Helix Turn Helix / Tryptophane clusters | n/a | taac | [4,471,912 / 4,471,916] | This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. |
4 | bHLH | n/a | catttg | [4,471,920 / 4,471,926] | This is one of the 2 E-box binding sites located in the notochord-active enhancer of KH.C5.399. |
5 | Fox | n/a | tgtttac | [4,471,981 / 4,471,988] | This is one of the 2 Fox binding sites located in the notochord-active enhancer of KH.C5.399. |
6 | Helix Turn Helix / Tryptophane clusters | n/a | attgaa | [4,472,025 / 4,472,031] | This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#2 binding site does not affect the enhancer activity in the notochord. |
7 | T-Box | n/a | gtgtta | [4,472,035 / 4,472,041] | This Brachyury binding site is located in the notochord-active enhancer of KH.C5.399. Mutation of this Brachyury binding site does not affect the enhancer activity in the notochord. |
8 | Helix Turn Helix / Tryptophane clusters | n/a | taac | [4,472,039 / 4,472,043] | This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#1 binding site does not affect the enhancer activity in the notochord. |
9 | bHLH | n/a | caaatg | [4,472,076 / 4,472,082] | This is one of the 2 E-box binding sites located in the notochord-active enhancer of KH.C5.399. |
10 | Fox | n/a | tgtttgt | [4,472,101 / 4,472,108] | This is one of the 2 Fox binding sites located in the notochord-active enhancer of KH.C5.399. |
11 | Helix Turn Helix / Tryptophane clusters | n/a | ttcaat | [4,472,129 / 4,472,135] | This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399. |
12 | Helix Turn Helix / Tryptophane clusters | n/a | ccgttg | [4,472,145 / 4,472,151] | This Myb#3 binding site is located in the notochord-active enhancer of KH.C5.399. Its mutation does not affect the enhancer activity in the notochord. |
Aniseed Coordinates: [4,471,738 / 4,472,163] on scaffold KhC5
The 5th Myb#1 and the second Myb#2 binding sites are mutated. TAAC replaced by TGGT and ATTGAA replaced by ACCAAA respectively. This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS1.d and TableS5 of Jose-Edwards et al. 2015.
tgccaggtatgtctaaattcaacagcttcggtaatggcgcattctttgtcataattatac
ggaggcaggctggtgtacgaagaaattccatttcgacacgacatgttgcgctgtagtgac
tcaagtttcaaagttatgttaagctttaagaaaagtgtagacaggcgtactgcttaacaa
aacatttgcagactattaaaaattatttaaagtattaataagcgctactttaatattttt
gtatgtttaccagtaatgagtttcgtacagaatacgttgcgccgtgaattgaaatgtgtg
ttaacttGGTctagaCCAaatgcattccgtctcgagtacaaatgcctttctgatttgttg
tcttgtttgttttgcgtctctctcgctcttgttcaatatttagaaagccgttgtgactat
gctgtg