Login
Help

Submit your Data

  1. Transcript 'Phfumi.CG.MTP2014.S3...'
  2. Transcript 'KH2012:KH.L96.17.v1....'
  3. Clone 'citb074k24'
  4. Clone 'cicl027p07'
  5. Region 'REG00001349'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.C5:4471987-4472163_Myb2-1Mut_Myb1-4Mut_Myb3-1Mut|Rfx1/2/3

Short name

n/a

Region ID

REG00001349

Status

Curated

Origin

engineered region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2018-05-08)

Annotator

Marion Gueroult-Bellone (2018-05-08)

Curator

Marion Gueroult-Bellone (2018-05-08)


Description

This 178bp sequence, located in the downstream region of KH.C5.399, drives reporter gene expression in notochord. It contains 1 Myb#1, 1 E-box, 1 Fox, 2 Myb#2 and 1 Brachyury putative binding sites. Compared to the active WT enhancer, it lacks 1 Myb#1, 1 Myb#2 and # Myb#3 binding sites.

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KH2012.C5:4471987-4472163|Rfx1/2/3 by substitution

Overview of functional TF binding sites in this region

4,471,9874,472,163

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 T-Box n/a gtgttG [4,472,035 / 4,472,041] This Brachyury binding site is located in the notochord-active enhancer of KH.C5.399. Mutation of this Brachyury binding site does not affect the enhancer activity in the notochord.
2 Helix Turn Helix / Tryptophane clusters n/a taac [4,472,044 / 4,472,048] This is one of the 5 Myb#1 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#1 binding site alone does not affect the enhancer activity in the notochord. Mutation of both this binding site and the neighbouring Myb#2 binding site inhibits enhancer activity in the notochord.
3 Helix Turn Helix / Tryptophane clusters n/a attgaa [4,472,052 / 4,472,058] This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399. Mutation of this Myb#2 binding site alone does not affect the enhancer activity in the notochord. Mutation of both this binding site and the neighbouring Myb#1 binding site inhibits enhancer activity in the notochord.
4 bHLH n/a caaatg [4,472,076 / 4,472,082] This is one of the 2 E-box binding sites located in the notochord-active enhancer of KH.C5.399.
5 Fox n/a tgtttgt [4,472,101 / 4,472,108] This is one of the 2 Fox binding sites located in the notochord-active enhancer of KH.C5.399.
6 Helix Turn Helix / Tryptophane clusters n/a ttcaat [4,472,129 / 4,472,135] This is one of the 3 Myb#2 binding sites located in the notochord-active enhancer of KH.C5.399.

Sequence

Aniseed Coordinates: [4,471,987 / 4,472,163] on scaffold KhC5

The 1st Myb#2, the 4th Myb#1 and the Myb#3 binding sites are mutated. ATTGAA replaced by ACCAAA ; TAAC replaced by TGGT adn CAACGG replaced by CGGTGG respectively. This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS1.d and TableS5 of Jose-Edwards et al. 2015.

Show sequence

Length: 177


ccagtaatgagtttcgtacagaatacgttgcgccgtgaaCCAaaatgtgtgttGGTttaa
cc
tagattgaatgcattccgtctcgagtacaaatgcctttctgatttgttgtcttgtttg
tt
ttgcgtctctctcgctcttgttcaatatttagaaagccACCgtgactatgctgtg





By clicking "SEND", you accept the terms of our Privacy Policy.