Login
Help

CIS-REGULATION

Submit your Data

  1. Region 'REG00000779' > 
  2. Region 'REG00001367'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.L128:214285-215033|Furin,Nec1/2

Short name

n/a

Region ID

REG00001367

Status

Curated

Origin

natural region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2018-05-13)

Annotator

Marion Gueroult-Bellone (2018-05-13)

Curator

Marion Gueroult-Bellone (2018-05-13)

View position in WashU

Description

This 749bp sequence, located in an intronic region of KH.L128.2, drives reporter gene expression in notochord, mesenchyme and central nervous system. It contains 2 Myb#2, 8 Brachyury, 3 Fox, 4 E-box, 1 Myb#3 and 1 Sp1/Klf putative binding sites.

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KH2012.L128:214285-215843|Furin,Nec1/2 by deletion

Regulated gene(s)

KH2012:KH.L128.2 (FURIN; PCSK1; PCSK2)

Construct(s) made to test this region

CONS00001387: p.Cirobu.REG.KH2012.L128:214285-215033>LacZ

Show in situ data
Overview of functional TF binding sites in this region

214,285215,033

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 Helix Turn Helix / Tryptophane clusters n/a ttcaat [214,363 / 214,369] This is the first of the 2 Myb#2 binding sites located on the notochord-active intronic enhancer of KH.L128.2. Deletion of the region containing this binding site and its neighbours reduces enhancer activity level.
2 T-Box n/a gtgcca [214,381 / 214,387] This is the first of the 8 Brachyrury binding sites located on the notochord-active intronic enhancer of KH.L128.2. Deletion of the region containing this binding site and its neighbours reduces enhancer activity level.
3 Fox n/a tatttat [214,400 / 214,407] This is the first of the 3 Fox binding sites located on the notochord-active intronic enhancer of KH.L128.2. Deletion of the region containing this binding site and its neighbours reduces enhancer activity level.
4 bHLH n/a cacgtg [214,480 / 214,486] This is the first of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2. Deletion of the region containing this binding site and its neighbours reduces enhancer activity level.
5 Helix Turn Helix / Tryptophane clusters n/a ccgttg [214,502 / 214,508] This Myb#3 binding site is located on the notochord-active intronic enhancer of KH.L128.2.
6 T-Box n/a tagcac [214,578 / 214,584] This is the second of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
7 bHLH n/a cacatg [214,581 / 214,587] This is the second of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2.
8 bHLH n/a catttg [214,593 / 214,599] This is the third of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2.
9 ZnF_(C2H2) n/a ccacc [214,616 / 214,621] This Sp1/Klf binding site is located on the notochord-active intronic enhancer of KH.L128.2.
10 T-Box n/a tttcac [214,633 / 214,639] This is the third of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
11 bHLH n/a cagatg [214,647 / 214,653] This is the fourth of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2.
12 T-Box n/a tgacac [214,680 / 214,686] This is the fourth of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation or the mutation of the adjacent bases inhibits the enhancer activity in the notochord.
13 T-Box n/a ttacac [214,697 / 214,703] This is the fifth of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
14 Fox n/a tatttgc [214,735 / 214,742] This is the second of the 2 Fox binding sites located on the notochord-active intronic enhancer of KH.L128.2.
15 T-Box n/a gtggaa [214,782 / 214,788] This is the 6th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
16 T-Box n/a gtgaaa [214,801 / 214,807] This is the 7th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
17 Fox n/a ataaaca [214,864 / 214,871] This is the third of the 3 Fox binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation does not affect enhancer activity in the notochord, but it increases activity in the mesenchyme.
18 Helix Turn Helix / Tryptophane clusters n/a attgaa [214,917 / 214,923] This is the second of the 2 Myb#2 binding sites located on the notochord-active intronic enhancer of KH.L128.2.
19 T-Box n/a gtgcca [214,965 / 214,971] This is the 8th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation decreases but does not inhibit enhancer activity in the notochord.

Sequence

Aniseed Coordinates: [214,285 / 215,033] on scaffold KhL128

This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS3.c and TableS5 of Jose-Edwards et al. 2015.

Show sequence

Length: 749


tttaaaaaagcaaaattgctacacctcaccacttactttctaaacccttgtgagctgtcg
tcgtcgtttggtcgtcgattcaataatatggaatcagtgccaaacggagacgtcatattt
atggtcaagtctccacggcgagaacttgcaatggtcagaaacgcctttggaatataagaa
gtaaaatacacgccccacgtggggctcgaacccacgaccgttggattaagagtccaacgc
tctaccgactgagctagcagggcggtagagatgaactgattaaggtatcctgttagcaca
tgcaacttcatttgtgattatagcattagaaccaccgccgcaacagtgtttcacaacaga
agcagatgaagcattttgttttttcttgtcaacactgacacttagttgttgattacactc
gcgcgtactttgcaagcttttttggtaagctatttgcttgtgaagctgtagcaatgtagc
aggacaaactactaaatgtggaaagtataaaacttagtgaaacgagtattttgtatatat
taatctggcatttaaaaatcagcgtttatgttagtttgtataaacagaactggctcgaat
tcaacatcaaagctattattgttattggtattattgaaggggatgaaaaaaacgccagtg
tttggtggatatactgatgtgtgccatgtacgctgccgtattttatatgtattcgttact
ttatacaatgtgttttgatgtatgcatgt

Reference(s)

José-Edwards et al. (2015). Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord. PLoS Genet. 11(12):e1005730

Back to Top