Login
Help

Submit your Data

  1. Region 'REG00001374'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.L128:214487-215033_Bra4Mut2|Furin,Nec1/2

Short name

n/a

Region ID

REG00001374

Status

Curated

Origin

engineered region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2018-05-16)

Annotator

Marion Gueroult-Bellone (2018-05-16)

Curator

Marion Gueroult-Bellone (2018-05-16)


Description

This 547bp sequence, located in an intronic region of KH.L128.2, drives reporter gene expression in mesenchyme and central nervous system. It contains 1 Myb#2, 6 Brachyury, 2 Fox, 3 E-box, 1 Myb#3 and 1 Sp1/Klf putative binding sites. Compared to the notochord-active WT enhancer, it lacks the 4th Brachyury binding site.

Overview of functional TF binding sites in this region

214,487215,033

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 Helix Turn Helix / Tryptophane clusters n/a ccgttg [214,502 / 214,508] This Myb#3 binding site is located on the notochord-active intronic enhancer of KH.L128.2.
2 T-Box n/a tagcac [214,578 / 214,584] This is the second of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
3 bHLH n/a cacatg [214,581 / 214,587] This is the second of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2.
4 bHLH n/a catttg [214,593 / 214,599] This is the third of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2.
5 ZnF_(C2H2) n/a ccacc [214,616 / 214,621] This Sp1/Klf binding site is located on the notochord-active intronic enhancer of KH.L128.2.
6 T-Box n/a tttcac [214,633 / 214,639] This is the third of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
7 bHLH n/a cagatg [214,647 / 214,653] This is the fourth of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2.
8 T-Box n/a ttacac [214,697 / 214,703] This is the fifth of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
9 Fox n/a tatttgc [214,735 / 214,742] This is the second of the 2 Fox binding sites located on the notochord-active intronic enhancer of KH.L128.2.
10 T-Box n/a gtggaa [214,782 / 214,788] This is the 6th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
11 T-Box n/a gtgaaa [214,801 / 214,807] This is the 7th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
12 Fox n/a ataaaca [214,864 / 214,871] This is the third of the 3 Fox binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation does not affect enhancer activity in the notochord, but it increases activity in the mesenchyme.
13 Helix Turn Helix / Tryptophane clusters n/a attgaa [214,917 / 214,923] This is the second of the 2 Myb#2 binding sites located on the notochord-active intronic enhancer of KH.L128.2.
14 T-Box n/a gtgcca [214,965 / 214,971] This is the 8th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation decreases but does not inhibit enhancer activity in the notochord.

Sequence

Aniseed Coordinates: [214,487 / 215,033] on scaffold KhL128

This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS3.c and TableS5 of Jose-Edwards et al. 2015. The 4th Brachyrury binding site is mutated. GTGTCA replaced by AGATCA.

Show sequence

Length: 547


ggctcgaacccacgaccgttggattaagagtccaacgctctaccgactgagctagcaggg
cggtagagatgaactgattaaggtatcctgttagcacatgcaacttcatttgtgattata
gcattagaaccaccgccgcaacagtgtttcacaacagaagcagatgaagcattttgtttt
ttcttgtcaacactgaTCTttagttgttgattacactcgcgcgtactttgcaagcttttt
tggtaagctatttgcttgtgaagctgtagcaatgtagcaggacaaactactaaatgtgga
aa
gtataaaacttagtgaaacgagtattttgtatatattaatctggcatttaaaaatcag
cgtttatgttagtttgtataaacagaactggctcgaattcaacatcaaagctattattgt
tattggtattattgaaggggatgaaaaaaacgccagtgtttggtggatatactgatgtgt
gccat
gtacgctgccgtattttatatgtattcgttactttatacaatgtgttttgatgta
tgcatgt





By clicking "SEND", you accept the terms of our Privacy Policy.

You may choose to prevent this website from aggregating and analyzing the actions you take here. Doing so will protect your privacy, but will also prevent the owner from learning from your actions and creating a better experience for you and other users.