Login
Help

CIS-REGULATION

Submit your Data

  1. Region 'REG00001544' > 
  2. Region 'REG00001375'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.L128:214487-215033_Bra4Mut3|Furin,Nec1/2

Short name

n/a

Region ID

REG00001375

Status

Curated

Origin

engineered region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2018-05-16)

Annotator

Marion Gueroult-Bellone (2018-05-16)

Curator

Marion Gueroult-Bellone (2018-05-16)

View position in WashU

Description

This 547bp sequence, located in an intronic region of KH.L128.2, drives reporter gene expression in tail muscles, mesenchyme and central nervous system, but not in the notochord as the WT enhancer does. It contains 1 Myb#2, 7 Brachyury, 2 Fox, 3 E-box, 1 Myb#3 and 1 Sp1/Klf putative binding sites.

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KH2012.L128:214487-215033|Furin,Nec1/2 by substitution

Regulated gene(s)

KH2012:KH.L128.2 (FURIN; PCSK1; PCSK2)

Construct(s) made to test this region

CONS00001395: p.Cirobu.REG.KH2012.L128:214487-215033_Bra4Mut3>LacZ

Show in situ data
Overview of functional TF binding sites in this region

214,487215,033

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 Helix Turn Helix / Tryptophane clusters n/a ccgttgg [214,502 / 214,509] This Myb#3 binding site is located on the notochord-active intronic enhancer of KH.L128.2.
2 T-Box n/a tagcac [214,578 / 214,584] This is the second of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
3 bHLH n/a cacatg [214,581 / 214,587] This is the second of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2.
4 bHLH n/a catttg [214,593 / 214,599] This is the third of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2.
5 ZnF_(C2H2) n/a ccacc [214,616 / 214,621] This Sp1/Klf binding site is located on the notochord-active intronic enhancer of KH.L128.2.
6 T-Box n/a tttcac [214,633 / 214,639] This is the third of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
7 bHLH n/a cagatg [214,647 / 214,653] This is the fourth of the 4 E-box binding sites located on the notochord-active intronic enhancer of KH.L128.2.
8 T-Box n/a tgacac [214,680 / 214,686] This is the fourth of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation or the mutation of the adjacent bases inhibits the enhancer activity in the notochord.
9 T-Box n/a ttacac [214,697 / 214,703] This is the fifth of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
10 Fox n/a tatttgc [214,735 / 214,742] This is the second of the 2 Fox binding sites located on the notochord-active intronic enhancer of KH.L128.2.
11 T-Box n/a gtggaa [214,782 / 214,788] This is the 6th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
12 T-Box n/a gtgaaa [214,801 / 214,807] This is the 7th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2.
13 Fox n/a ataaaca [214,864 / 214,871] This is the third of the 3 Fox binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation does not affect enhancer activity in the notochord, but it increases activity in the mesenchyme.
14 Helix Turn Helix / Tryptophane clusters n/a attgaa [214,917 / 214,923] This is the second of the 2 Myb#2 binding sites located on the notochord-active intronic enhancer of KH.L128.2.
15 T-Box n/a gtgcca [214,965 / 214,971] This is the 8th of the 8 Brachyury binding sites located on the notochord-active intronic enhancer of KH.L128.2. Its mutation decreases but does not inhibit enhancer activity in the notochord.

Sequence

Aniseed Coordinates: [214,487 / 215,033] on scaffold KhL128

This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS3.c and TableS5 of Jose-Edwards et al. 2015. The sequence located directly next to the 4th Brachyrury binding site is mutated. ctaaGTGTCA replaced by agccGTGTCA.

Show sequence

Length: 547


ggctcgaacccacgaccgttggattaagagtccaacgctctaccgactgagctagcaggg
cggtagagatgaactgattaaggtatcctgttagcacatgcaacttcatttgtgattata
gcattagaaccaccgccgcaacagtgtttcacaacagaagcagatgaagcattttgtttt
ttcttgtcaacactgacacGTTAttgttgattacactcgcgcgtactttgcaagcttttt
tggtaagctatttgcttgtgaagctgtagcaatgtagcaggacaaactactaaatgtgga
aagtataaaacttagtgaaacgagtattttgtatatattaatctggcatttaaaaatcag
cgtttatgttagtttgtataaacagaactggctcgaattcaacatcaaagctattattgt
tattggtattattgaaggggatgaaaaaaacgccagtgtttggtggatatactgatgtgt
gccatgtacgctgccgtattttatatgtattcgttactttatacaatgtgttttgatgta
tgcatgt

Reference(s)

José-Edwards et al. (2015). Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord. PLoS Genet. 11(12):e1005730

Back to Top