- Clone 'cilv033o21' >
- Clone 'citb080i12' >
- Region 'REG00001377'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.C7:3853970-3854222_LSM2|Ephrin3
Short name
n/a
Region ID
REG00001377
Status
Curated
Origin
engineered region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2018-05-21)
Annotator
Marion Gueroult-Bellone (2018-05-21)
Curator
Marion Gueroult-Bellone (2018-05-21)
This 253bp sequence, located in an intronic region of C7.568, drives reporter gene expression in notochord, mesenchyme and head epidermis. It contains 2 Brachyury, 2 Fox, 1 E-box and 1 Sp1/Klf putative binding sites and an (AC) repeat. Compared to the WT 253pb enhancer, its ability to direct notochord gene expression is weaker.
Modification of Cirobu.REG.KH2012.C7:3853970-3854222|Ephrin3 by substitution
- Cirobu.REG.KH2012.C7:3853138-3854780|Ephrin3 REG00001277 [ regulatory_region (complex_region) ]
- Cirobu.REG.KH2012.C7:3853138-3853945|Ephrin3 REG00001278 [ no_output ]
- Cirobu.REG.KH2012.C7:3853910-3854222|Ephrin3 REG00001279 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853910-3854157|Ephrin3 REG00001280 [ no_output ]
- Cirobu.REG.KH2012.C7:3853970-3854222|Ephrin3 REG00001281 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854157|Ephrin3 REG00001282 [ no_output ]
- Cirobu.REG.KH2012.C7:3853970-3854222_Bra2mut|Ephrin3 REG00001284 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_FSM1|Ephrin3 REG00001376 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_LSM2|Ephrin3 REG00001377 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_LSM3|Ephrin3 REG00001378 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_LSM4|Ephrin3 REG00001379 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_LSM5|Ephrin3 REG00001380 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_LSM6|Ephrin3 REG00001381 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_LSM7|Ephrin3 REG00001382 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_(AC)2mut|Ephrin3 REG00001383 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853970-3854222_(AC)6mut|Ephrin3 REG00001384 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C7:3853910-3854222_Bra2Fox2mut|Ephrin3 REG00001283 [ regulatory_region (enhancer) ]
CONS00001397: p.Cirobu.REG.KH2012.C7:3853970-3854222_LSM2>LacZ
3,853,9703,854,222
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | ZnF_(C2H2) | n/a | ccacc | [3,853,992 / 3,853,997] | This Sp1/Klf binding site is located on the notochord-active intronic enhancer of KH.C7.568. |
2 | T-Box | n/a | tcacac | [3,854,037 / 3,854,043] | This is the first of the 2 Brachyury binding sites located on the notochord-active intronic enhancer of KH.C7.568. |
3 | Fox | n/a | tatttgt | [3,854,049 / 3,854,056] | This is the 1st of the 2 Fox binding sites located on the 253bp notochord-active intronic enhancer of KH.C7.568. |
4 | T-Box | n/a | tcacac | [3,854,158 / 3,854,164] | This is the 2nd of the 2 Brachyury binding sites located on the 253bp notochord-active intronic enhancer of KH.C7.568. Its mutation does not inhibit enhancer activity in the notochord. |
5 | bHLH | n/a | cagatg | [3,854,195 / 3,854,201] | This E-box binding site is located on the 253bp notochord-active intronic enhancer of KH.C7.568. |
6 | Fox | n/a | ataaaca | [3,854,205 / 3,854,212] | This is the 2nd of the 2 Fox binding sites located on the 253bp notochord-active intronic enhancer of KH.C7.568. |
Aniseed Coordinates: [3,853,970 / 3,854,222] on scaffold KhC7
This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in Fig3.b and TableS5 of Jose-Edwards et al. 2015. This construct is part of mutational series of the last 59bp. Mutated bases are shown in upper-case letters.
ctctacagtatacggagagtccccacccattaaacaaacgtaatattaattgttagatag
atatgattcacacaggatgtatttgtggtgtctggattaacccccagtaagaattctctg
ccatacaatagcagcgtgtttgaattactgcttgttttggcaagttgattaagtcaggtc
aatctaggtcacacacacacaACGCAGCAatgtatatacacaacacagatgtaatataaa
cattgtagtattg