Login
Help

CIS-REGULATION

Submit your Data

  1. Clone 'cima826934' > 
  2. Region 'REG00001289' > 
  3. Clone 'cibd084p19' > 
  4. Clone 'citb13k7' > 
  5. Region 'REG00001385'

Cis-regulatory Region

Name

Cirobu.REG.KH2012.C5:4471738-4472163_Myb2-2orientationReversed|Rfx1/2/3

Short name

n/a

Region ID

REG00001385

Status

Curated

Origin

engineered region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2018-05-23)

Annotator

Marion Gueroult-Bellone (2018-05-23)

Curator

Marion Gueroult-Bellone (2018-05-23)

View position in WashU

Description

This 433bp sequence, located downstream of C5.399, drives reporter gene expression in notochord, head epidermis and mesenchyme. It contains 1 Brachyury, 2 Fox, 2 E-box, 5 Myb#1, 3 Myb#2 and 1 Myb3 putative binding sites. Changing the orientation of the second Myb#2 binding site does not affect much the enhancer activity.

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KH2012.C5:4471738-4472163|Rfx1/2/3 by substitution

Regulated gene(s)

KH2012:KH.C5.399 (RFX1; RFX2; RFX3)

Construct(s) made to test this region

CONS00001405: p.Cirobu.REG.KH2012.C5:4471738-4472163_Myb2-2orientationReversed>LacZ

Show in situ data
Overview of functional TF binding sites in this region

4,471,7384,472,163

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 Helix Turn Helix / Tryptophane clusters n/a gtta [4,471,870 / 4,471,874] This is the first of the 5 Myb#1 binding sites located on the notochord-active enhancer of KH.C5.399.
2 Helix Turn Helix / Tryptophane clusters n/a gtta [4,471,875 / 4,471,879] This is the second of the 5 Myb#1 binding sites located on the 433bp notochord-active enhancer of KH.C5.399.
3 Helix Turn Helix / Tryptophane clusters n/a taac [4,471,912 / 4,471,916] This is the third of the 5 Myb#1 binding sites located on the 433bp notochord-active enhancer of KH.C5.399.
4 bHLH n/a catttg [4,471,920 / 4,471,926] This is the first of the 2 E-box binding sites located on the 433bp notochord-active enhancer of KH.C5.399.
5 Fox n/a tgtttac [4,471,981 / 4,471,988] This is the first of the 2 Fox binding sites located on the 433bp notochord-active enhancer of KH.C5.399.
6 Helix Turn Helix / Tryptophane clusters n/a attgaa [4,472,025 / 4,472,031] This is the first of the 3 Myb#2 binding sites located on the 433bp notochord-active enhancer of KH.C5.399. Its mutation does not inhibit enhancer activity in the notochord.
7 T-Box n/a gtgtta [4,472,035 / 4,472,041] This Brachyury binding site is located on the 433bp notochord-active enhancer of KH.C5.399. Its mutation does not inhibit enhancer activity in the notochord.
8 T-Box n/a taac [4,472,039 / 4,472,043] This is the 4th of the 5 Myb#1 binding sites located on the 433bp notochord-active enhancer of KH.C5.399. Its mutation does not inhibit enhancer activity in the notochord.
9 Helix Turn Helix / Tryptophane clusters n/a taac [4,472,044 / 4,472,048] This is the 5th of the 5 Myb#1 binding sites located on the 433bp notochord-active enhancer of KH.C5.399. Its mutation does not inhibit enhancer activity in the notochord.
10 Helix Turn Helix / Tryptophane clusters n/a TTCAAT [4,472,052 / 4,472,058] This is the 2nd of the 3 Myb#2 binding sites located on the 433bp notochord-active enhancer of KH.C5.399. Its mutation does not inhibit enhancer activity in the notochord. In this construct, its orientation is reversed.
11 bHLH n/a caaatg [4,472,076 / 4,472,082] This is the 2nd of the 2 E-box binding sites located on the 433bp notochord-active enhancer of KH.C5.399.
12 Fox n/a tgtttgt [4,472,101 / 4,472,108] This is the 2nd of the 2 Fox binding sites located on the 433bp notochord-active enhancer of KH.C5.399.
13 Helix Turn Helix / Tryptophane clusters n/a ttcaat [4,472,129 / 4,472,135] This is the 3rd of the 3 Myb#2 binding sites located on the 433bp notochord-active enhancer of KH.C5.399.
14 Helix Turn Helix / Tryptophane clusters n/a ccgttg [4,472,145 / 4,472,151] This Myb#3 binding site is located on the 433bp notochord-active enhancer of KH.C5.399. Its mutation does not inhibit enhancer activity in the notochord.

Sequence

Aniseed Coordinates: [4,471,738 / 4,472,163] on scaffold KhC5

This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS4.b and TableS5 of Jose-Edwards et al. 2015. In this construct the orientation of the 2nd Myb#2 binding site is reversed . Mutated bases are shown in upper-case letters.

Show sequence

Length: 426


tgccaggtatgtctaaattcaacagcttcggtaatggcgcattctttgtcataattatac
ggaggcaggctggtgtacgaagaaattccatttcgacacgacatgttgcgctgtagtgac
tcaagtttcaaagttatgttaagctttaagaaaagtgtagacaggcgtactgcttaacaa
aacatttgcagactattaaaaattatttaaagtattaataagcgctactttaatattttt
gtatgtttaccagtaatgagtttcgtacagaatacgttgcgccgtgaattgaaatgtgtg
ttaacttaacctagTTCAATtgcattccgtctcgagtacaaatgcctttctgatttgttg
tcttgtttgttttgcgtctctctcgctcttgttcaatatttagaaagccgttgtgactat
gctgtg

Reference(s)

José-Edwards et al. (2015). Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord. PLoS Genet. 11(12):e1005730

Back to Top