- Region 'REG00001387'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.C5:4471738-4472163_insertion|Rfx1/2/3
Short name
n/a
Region ID
REG00001387
Status
Curated
Origin
engineered region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2018-05-23)
Annotator
Marion Gueroult-Bellone (2018-05-23)
Curator
Marion Gueroult-Bellone (2018-05-23)
This 4333bp sequence, located downstream of C5.399, drives reporter gene expression in notochord, central nervous system and mesenchyme. It contains 1 Brachyury, 2 Fox, 2 E-box, 5 Myb#1, 3 Myb#2 and 1 Myb3 putative binding sites. Changing the spacing between the second Myb#2 and the 5th Myb#1 binding sites decreases enhancer activity in the notochord.
Modification of Cirobu.REG.KH2012.C5:4471738-4472163|Rfx1/2/3 by insertion
- Cirobu.REG.KH2012.C5:4471567-4472163|Rfx1/2/3 REG00001341 [ regulatory_region (complex_region) ]
- Cirobu.REG.KH2012.C5:4471738-4472163|Rfx1/2/3 REG00001342 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5Mut|Rfx1/2/3 REG00001343 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb2-2Mut|Rfx1/2/3 REG00001344 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5Mut_Myb2-2Mut|Rfx1/2/3 REG00001345 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471851-4472163|Rfx1/2/3 REG00001346 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb2-2orientationReversed|Rfx1/2/3 REG00001385 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_Myb1-5/Myb2-2exchange|Rfx1/2/3 REG00001386 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163_insertion|Rfx1/2/3 REG00001387 [ regulatory_region (enhancer) ]
- Cirobu.REG.KH2012.C5:4471738-4472163|Rfx1/2/3 REG00001342 [ regulatory_region (enhancer) ]
CONS00001407: p.Cirobu.REG.KH2012.C5:4471738-4472163_insertion>lacZ
4,471,7384,472,167
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | Helix Turn Helix / Tryptophane clusters | n/a | gtta | [4,471,870 / 4,471,874] | This is the first of the 5 Myb#1 binding sites located on the notochord-active enhancer of KH.C5.399. |
2 | Helix Turn Helix / Tryptophane clusters | n/a | gtta | [4,471,875 / 4,471,879] | This is the second of the 5 Myb#1 binding sites located on the 433bp notochord-active enhancer of KH.C5.399. |
3 | Helix Turn Helix / Tryptophane clusters | n/a | taac | [4,471,912 / 4,471,916] | This is the third of the 5 Myb#1 binding sites located on the 433bp notochord-active enhancer of KH.C5.399. |
4 | bHLH | n/a | catttg | [4,471,920 / 4,471,926] | This is the first of the 2 E-box binding sites located on the 433bp notochord-active enhancer of KH.C5.399. |
5 | Fox | n/a | tgtttac | [4,471,981 / 4,471,988] | This is the first of the 2 Fox binding sites located on the 433bp notochord-active enhancer of KH.C5.399. |
6 | Helix Turn Helix / Tryptophane clusters | n/a | attgaa | [4,472,025 / 4,472,031] | This is the first of the 3 Myb#2 binding sites located on the 433bp notochord-active enhancer of KH.C5.399. Its mutation does not inhibit enhancer activity in the notochord. |
7 | T-Box | n/a | gtgtta | [4,472,035 / 4,472,041] | This Brachyury binding site is located on the 433bp notochord-active enhancer of KH.C5.399. Its mutation does not inhibit enhancer activity in the notochord. |
8 | Helix Turn Helix / Tryptophane clusters | n/a | taac | [4,472,039 / 4,472,043] | This is the 4th of the 5 Myb#1 binding sites located on the 433bp notochord-active enhancer of KH.C5.399. Its mutation does not inhibit enhancer activity in the notochord. |
9 | Helix Turn Helix / Tryptophane clusters | n/a | taac | [4,472,044 / 4,472,048] | This is the 5th of the 5 Myb#1 binding sites located on the 433bp notochord-active enhancer of KH.C5.399. Its mutation does not inhibit enhancer activity in the notochord. |
10 | Helix Turn Helix / Tryptophane clusters | n/a | attgaa | [4,472,056 / 4,472,062] | This is the 2nd of the 3 Myb#2 binding sites located on the 433bp notochord-active enhancer of KH.C5.399. Its mutation does not inhibit enhancer activity in the notochord. |
11 | bHLH | n/a | caaatg | [4,472,080 / 4,472,086] | This is the 2nd of the 2 E-box binding sites located on the 433bp notochord-active enhancer of KH.C5.399. |
12 | Fox | n/a | tgtttgt | [4,472,105 / 4,472,112] | This is the 2nd of the 2 Fox binding sites located on the 433bp notochord-active enhancer of KH.C5.399. |
13 | Helix Turn Helix / Tryptophane clusters | n/a | ttcaat | [4,472,133 / 4,472,139] | This is the 3rd of the 3 Myb#2 binding sites located on the 433bp notochord-active enhancer of KH.C5.399. |
14 | Helix Turn Helix / Tryptophane clusters | n/a | ccgttg | [4,472,149 / 4,472,155] | This Myb#3 binding site is located on the 433bp notochord-active enhancer of KH.C5.399. Its mutation does not inhibit enhancer activity in the notochord. |
Aniseed Coordinates: [4,471,738 / 4,472,167] on scaffold KhC5
This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in FigS4.d and TableS5 of Jose-Edwards et al. 2015. In this construct the 4 bases located between the 2nd Myb#2 and the 5th Myb#1 binding sites are duplicated . Inserted bases are shown in upper-case letters.
tgccaggtatgtctaaattcaacagcttcggtaatggcgcattctttgtcataattatac
ggaggcaggctggtgtacgaagaaattccatttcgacacgacatgttgcgctgtagtgac
tcaagtttcaaagttatgttaagctttaagaaaagtgtagacaggcgtactgcttaacaa
aacatttgcagactattaaaaattatttaaagtattaataagcgctactttaatattttt
gtatgtttaccagtaatgagtttcgtacagaatacgttgcgccgtgaattgaaatgtgtg
ttaacttaacctagCTAGattgaatgcattccgtctcgagtacaaatgcctttctgattt
gttgtcttgtttgttttgcgtctctctcgctcttgttcaatatttagaaagccgttgtga
ctatgctgtg