- Region 'REG00001393'
Cis-regulatory Region
Name
Cirobu.REG.KH2012.S605:17409-17833|βγ-crystallin
Short name
n/a
Region ID
REG00001393
Status
Curated
Origin
natural region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(extended_promoter)
Author
Wei-Chung Chen (2018-05-25)
Annotator
Marion Gueroult-Bellone (2018-05-25)
Curator
Marion Gueroult-Bellone (2018-05-25)
This 425bp sequence, located in the intergenic region upstream of βγ-crystallin (S605.3), drives reporter gene expression in palps and pigment cells. It contains 315bp upstream of the TSS and 110bp downstream. It contains 1 Sox, 2 Cdx, 1 Fox, 1 CREB and 1 Nkx/POU putative binding sites conserved with Ciona savigny.
Modification of Cirobu.REG.KH2012.S605:17209-17833|βγ-crystallin by deletion
- Cirobu.REG.KH2012.S605:16609-17833|βγ-crystallin REG00001389 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:16789-17833|βγ-crystallin REG00001202 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:16809-17833|βγ-crystallin REG00001390 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17009-17833|βγ-crystallin REG00001391 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17209-17833|βγ-crystallin REG00001392 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17409-17833|βγ-crystallin REG00001393 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17448-17833|βγ-crystallin REG00001394 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17471-17833|βγ-crystallin REG00001395 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17540-17833|βγ-crystallin REG00001396 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17448-17833_SoxMut|βγ-crystallin REG00001399 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17448-17833_Cdx1Mut|βγ-crystallin REG00001400 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17448-17833_FoxMut|βγ-crystallin REG00001402 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17448-17833_CREBmut|βγ-crystallin REG00001403 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17448-17833|βγ-crystallin REG00001394 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17409-17833|βγ-crystallin REG00001393 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17209-17833|βγ-crystallin REG00001392 [ regulatory_region (extended_promoter) ]
- Cirobu.REG.KH2012.S605:17009-17833|βγ-crystallin REG00001391 [ regulatory_region (extended_promoter) ]
17,40917,833
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | SOX | n/a | aacaat | [17,460 / 17,466] | This Sox binding site is located on the intergenic cis-regulatory region of βγ-crystallin (S605.3). It is conserved with Ciona savigny. Mutation of this binding site or deletion of the region containing this binding site inhibit enhancer activity in pigment cells. |
2 | Homeobox | n/a | aattat | [17,533 / 17,539] | This is the 1st of the 2 Cdx binding sites located on the cis-regulatory region of βγ-crystallin (S605.3). It is conserved with Ciona savigny. Mutation of this binding site inhibits enhancer activity in pigment cells. So does the deletion of the region containing this binding site and its upstream neighbours. |
3 | Homeobox | n/a | aattat | [17,541 / 17,547] | This is the 2nd of the 2 Cdx binding sites located on the cis-regulatory region of βγ-crystallin (S605.3). It is conserved with Ciona savigny. Mutation of both Cdx binding sites inhibits enhancer activity in pigment cells and palps. So does the deletion of the region containing this binding site and its upstream neighbours. |
4 | Fox | n/a | tgtttgt | [17,555 / 17,562] | This Fox binding site is located on the cis-regulatory region of βγ-crystallin (S605.3). It is conserved with Ciona savigny. Mutation of this Fox binding site inhibits enhancer activity in pigment cells and reduces enhancer activity in palps. |
5 | bZIP | n/a | gtcataa | [17,617 / 17,624] | This CREB binding site is located on the cis-regulatory region of βγ-crystallin (S605.3). It is conserved with Ciona savigny. Mutation of this CREB binding site inhibits enhancer activity in pigment cells. |
6 | Homeobox | n/a | tgtta | [17,624 / 17,629] | This Nkx/POU binding site is located on the cis-regulatory region of βγ-crystallin (S605.3). It is conserved with Ciona savigny. |
Aniseed Coordinates: [17,409 / 17,833] on scaffold KhS605
This sequence was retrieved using ANISEED Blast tool, thanks to the information provided in Fig1 of Chen et al. 2014.
cttggtgcttaaaagggagcttatgacgtattaatgaactttaattattaaaacaatctt
gcttatcgtgctgtgttacgtcataatacatgcattagcaattactttgttttgtcataa
tatgaattatgtaattatcgtgacgttgtttgttttaaaaacccatttattattacgtca
taatactttagatggttgtgtatgttacgtcataatgttaattgttgaataaaaatgaag
aaacaaagccatgaagaaggcggtttgttataaaacattgttgaagggatggaattaatt
atgttgttaacgtttgaattattgatgtaacaaggacgacaagtgagcgcaaatcagatt
tcgtttactttccttctaaccctcctaaccactgcttatttcgcattttgtacaatcgaa
gtttc