Description

This 197bp enhancer is located upstream (-603/-407) of Rx TSS. Associated with the basal promoter of the human β-globin, it drives reporter gene activity in the central nervous system of Ciona robusta tailbuds and larvae.

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KH2012.C12:1333534-1334025|Rx by deletion

Regulated gene(s)

KH2012:KH.C12.152 (PAX6; RAX; RAX2)

Construct(s) made to test this region

CONS00001613: p.Cirobu.REG.KH2012.C12:1333829-1334025>LacZ

Overview of functional TF binding sites in this region

1,333,8291,334,025

	Motif Name	Binding Factor(s)	Sequence	Position in Region	Comment
1	Homeobox	n/a	ATCA	[1,333,845 / 1,333,849]	This Clox putative binding site is highly conserved with Ciona savigny. When mutated, the activity of the smaller J-A enhancer is lost.
2	Homeobox	KH2012:KH.C6.185	TCAA	[1,333,987 / 1,333,991]	This Onecut putative binding site is highly conserved with Ciona savigny. When mutated, the activity of the J0.2 enhancer is reduced.

Sequence

Aniseed Coordinates: [1,333,829 / 1,334,025] on scaffold KhC12

This 197bp enhancer was amplified using the following primers: J .2 up: ATCGCGTTTTCATTTTATCAATAA and J 0.2 down: ATATGGCCGTGTATCGCCAGATGGTAA

Reference(s)

D'Aniello et al. (2011). Onecut is a direct neural-specific transcriptional activator of Rx in Ciona intestinalis. Dev. Biol. 355(2):358-71