Login
Help

CIS-REGULATION

Submit your Data

  1. Transcript 'KH2012:KH.C1.855.v1....'
  2. Transcript 'KH2012:KH.C2.712.v1....'
  3. Transcript 'Cisavi.CG.ENS81.R27....'
  4. Transcript 'KH2012:KH.C12.142.v1...'
  5. Region 'REG00001575'

Cis-regulatory Region

Name

Cirobu.REG.KhL96:471236-471527|Tbx2/3

Short name

Tbx2/3_294bp (José-Edwards 2013)

Region ID

REG00001575

Status

Curated

Origin

natural region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2023-02-23)

Annotator

Marion Gueroult-Bellone (2023-02-23)

Curator

Marion Gueroult-Bellone (2023-02-23)


Description

This cis-regulatory element contains the T-box binding sites cluster located in 3' of the larger CRM (1937bp).

Overview of functional TF binding sites in this region

471,236471,527

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 T-Box n/a TGCCAC [471,276 / 471,282] 1st of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3.
2 T-Box n/a TGACAC [471,303 / 471,309] 2nd of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3.
3 T-Box n/a GTGGGA [471,326 / 471,332] 3rd of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3.
4 T-Box n/a TGACAC [471,361 / 471,367] 4th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3.
5 T-Box n/a GTGTTA [471,371 / 471,377] 5th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. It's mutation alone increase the enhancer notochord activity and specificity. Mutated togeter with T-box5 and/or T-box7, it abrogates the notochord activity.
6 T-Box n/a GTGACA [471,390 / 471,396] 6th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. It's mutation alone increase the enhancer notochord activity and specificity. Mutated togeter with T-box5 and/or T-box7, it abrogates the notochord activity.
7 T-Box n/a TAACAC [471,404 / 471,410] 7th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. It's mutation alone does not affect the enhancer notochord activity and specificity. Mutated togeter with T-box5 and/or T-box6, it abrogates the notochord activity.
8 T-Box n/a TTTCAC [471,447 / 471,453] 8th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3.
9 T-Box n/a TAGCAC [471,476 / 471,482] 9th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3.

Sequence

Aniseed Coordinates: [471,236 / 471,527] on scaffold KhL96

This 294bp region is located in the 3rd intron of Tbx2/3. It is a cluster of 9 Ci-Bra and Ci-Tbx6b binding sites ascertained from ChIP-chip data. Primers used to amplify this region : (294bp) F: tctagaGTGGACAGACAGGGTAGTTAAATAC and (172bp) R: TAccatggGTTATTTGTTCTTGTCACA This region is active in the notochord, and a bit in tail muscles and mesenchyme.

Show sequence

Length: 292


GTGGACAGACAGGGTAGTTAAATACGTTACAAAGTTCATTTGCCACCCAGCACAGTATTG
TACTTTATGACACTTGTGTTTATTCGTATAGTGGGACTAGTTATAAAATAAAACGGTTTA
TTCTCTGACACGTAAGTGTTAATCTATAAGCAATGTGACAAGAACAAATAACACGAAGGG
GCGAAATCTAACGCTAGATCAACTGCGTGGCTTTCACATCTTTGGTGGTCGAGTAATACA
TAGCACTAAACCGAAACAATTATTTTTCGTCGACTACCGTAATCCCCATTCC