Login
Help

CIS-REGULATION

Submit your Data

  1. Region 'REG00001575'

Cis-regulatory Region

Name

Cirobu.REG.KhL96:471236-471527|Tbx2/3

Short name

Tbx2/3_294bp (José-Edwards 2013)

Region ID

REG00001575

Status

Curated

Origin

natural region from C. robusta formely Ciona int. type A

Type of Activity

regulatory_region
(enhancer)

Author

Diana S. José-Edwards (2023-02-23)

Annotator

Marion Gueroult-Bellone (2023-02-23)

Curator

Marion Gueroult-Bellone (2023-02-23)

View position in WashU

Description

This cis-regulatory element contains the T-box binding sites cluster located in 3' of the larger CRM (1937bp).

Hierarchy of Regulatory Regions

Modification of Cirobu.REG.KhL96:469627-471527|Tbx2/3 by deletion

Regulated gene(s)

KH2012:KH.L96.87 (TBX2; TBX3; TBX4)

Construct(s) made to test this region

CONS00001665: p.Cirobu.REG.KhL96:471236-471527>LacZ

Show in situ data
Overview of functional TF binding sites in this region

471,236471,527

Motif Name Binding Factor(s) Sequence Position in Region Comment
1 T-Box n/a TGCCAC [471,276 / 471,282] 1st of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3.
2 T-Box n/a TGACAC [471,303 / 471,309] 2nd of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3.
3 T-Box n/a GTGGGA [471,326 / 471,332] 3rd of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3.
4 T-Box n/a TGACAC [471,361 / 471,367] 4th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3.
5 T-Box n/a GTGTTA [471,371 / 471,377] 5th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. It's mutation alone increase the enhancer notochord activity and specificity. Mutated togeter with T-box5 and/or T-box7, it abrogates the notochord activity.
6 T-Box n/a GTGACA [471,390 / 471,396] 6th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. It's mutation alone increase the enhancer notochord activity and specificity. Mutated togeter with T-box5 and/or T-box7, it abrogates the notochord activity.
7 T-Box n/a TAACAC [471,404 / 471,410] 7th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3. It's mutation alone does not affect the enhancer notochord activity and specificity. Mutated togeter with T-box5 and/or T-box6, it abrogates the notochord activity.
8 T-Box n/a TTTCAC [471,447 / 471,453] 8th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3.
9 T-Box n/a TAGCAC [471,476 / 471,482] 9th of the 9 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 294bp notochord enhancer of Tbx2/3.

Sequence

Aniseed Coordinates: [471,236 / 471,527] on scaffold KhL96

This 294bp region is located in the 3rd intron of Tbx2/3. It is a cluster of 9 Ci-Bra and Ci-Tbx6b binding sites ascertained from ChIP-chip data. Primers used to amplify this region : (294bp) F: tctagaGTGGACAGACAGGGTAGTTAAATAC and (172bp) R: TAccatggGTTATTTGTTCTTGTCACA This region is active in the notochord, and a bit in tail muscles and mesenchyme.

Show sequence

Length: 292


GTGGACAGACAGGGTAGTTAAATACGTTACAAAGTTCATTTGCCACCCAGCACAGTATTG
TACTTTATGACACTTGTGTTTATTCGTATAGTGGGACTAGTTATAAAATAAAACGGTTTA
TTCTCTGACACGTAAGTGTTAATCTATAAGCAATGTGACAAGAACAAATAACACGAAGGG
GCGAAATCTAACGCTAGATCAACTGCGTGGCTTTCACATCTTTGGTGGTCGAGTAATACA
TAGCACTAAACCGAAACAATTATTTTTCGTCGACTACCGTAATCCCCATTCC

Reference(s)

José-Edwards et al. (2013). Tbx2/3 is an essential mediator within the Brachyury gene network during Ciona notochord development. Development 140(11):2422-33

Back to Top