- Region 'REG00000295' >
- Region 'REG00000565' >
- Transcript 'Cisavi.CG.ENS81.R14....' >
- Transcript 'KH2012:KH.S742.2.v2....' >
- Region 'REG00001576'
Cis-regulatory Region
Name
Cirobu.REG.KhL96:471236-471407|Tbx2/3
Short name
Tbx2/3_172bp (José-Edwards 2013)
Region ID
REG00001576
Status
Curated
Origin
natural region from C. robusta formely Ciona int. type A
Type of Activity
regulatory_region
(enhancer)
Author
Diana S. José-Edwards (2023-02-23)
Annotator
Marion Gueroult-Bellone (2023-02-23)
Curator
Marion Gueroult-Bellone (2023-02-23)
Compared to its mother sequence (Tbx2/3_294bp), it lacks T-box binding sites #7, 8 and 9. Its activity is strongly reduced.
Modification of Cirobu.REG.KhL96:471236-471527|Tbx2/3 by deletion
- Cirobu.REG.KhL96:469627-471527|Tbx2/3 REG00001574 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527|Tbx2/3 REG00001575 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox5-6-7-mut|Tbx2/3 REG00001585 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox5-7-mut|Tbx2/3 REG00001584 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox6-7-mut|Tbx2/3 REG00001583 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox5-6-mut|Tbx2/3 REG00001582 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox7-mut|Tbx2/3 REG00001581 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox6-mut|Tbx2/3 REG00001580 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527_Tbox5-mut|Tbx2/3 REG00001579 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471379-471527|Tbx2/3 REG00001577 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471407|Tbx2/3 REG00001576 [ regulatory_region (enhancer) ]
- Cirobu.REG.KhL96:471236-471527|Tbx2/3 REG00001575 [ regulatory_region (enhancer) ]
471,236471,407
Motif Name | Binding Factor(s) | Sequence | Position in Region | Comment | |
---|---|---|---|---|---|
1 | T-Box | n/a | TGCCAC | [471,276 / 471,282] | 1st of the 6 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 172bp notochord enhancer of Tbx2/3. |
2 | T-Box | n/a | TGACAC | [471,303 / 471,309] | 2nd of the 6 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 172bp enhancer of Tbx2/3. |
3 | T-Box | n/a | GTGGGA | [471,326 / 471,332] | 3rd of the 6 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 172bp notochord enhancer of Tbx2/3. |
4 | T-Box | n/a | TGACAC | [471,361 / 471,367] | 4th of the 6 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 172bp notochord enhancer of Tbx2/3. |
5 | T-Box | n/a | GTGTTA | [471,371 / 471,377] | 5th of the 6 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 172bp enhancer of Tbx2/3. |
6 | T-Box | n/a | GTGACA | [471,390 / 471,396] | 6th of the 6 T-box binding sites ascertained from ChIP-chip data (Kubo et al., 2010), from the 172bp enhancer of Tbx2/3. |
Aniseed Coordinates: [471,236 / 471,407] on scaffold KhL96
This 172bp region is located in the 3rd intron of Tbx2/3. It is a cluster of 6 Ci-Bra and Ci-Tbx6b binding sites ascertained from ChIP-chip data. Primers used to amplify this region : (294bp) F: AtctagaGTGGACAGACAGGGTAGTTAAATAC and (172bp) R: TAccatggGTTATTTGTTCTTGTCACA This region is weakly active in the notochord, in tail muscles and in the sensory vesicle.
GTGGACAGACAGGGTAGTTAAATACGTTACAAAGTTCATTTGCCACCCAGCACAGTATTG
TACTTTATGACACTTGTGTTTATTCGTATAGTGGGACTAGTTATAAAATAAAACGGTTTA
TTCTCTGACACGTAAGTGTTAATCTATAAGCAATGTGACAAGAACAAATAAC