Aniseed - Gene Card

EST count

27 results

Library Name	Percentage	Expression
Ciona intestinalis whole animal Ciona intestinalis whole animal		0 clone(s) / 0
Nori Satoh unpublished cDNA library Nori Satoh unpublished cDNA library		31 clone(s) / 5,577
Nori Satoh unpublished cDNA library, young adult Nori Satoh unpublished cDNA library, young adult		4 clone(s) / 31,366
Nori Satoh unpublished cDNA library, cleavage stage embryo Nori Satoh unpublished cDNA library, cleavage stage embryo		3 clone(s) / 15,579
Nori Satoh unpublished cDNA library, egg Nori Satoh unpublished cDNA library, egg		0 clone(s) / 31,100
Nori Satoh unpublished cDNA library, larva Nori Satoh unpublished cDNA library, larva		95 clone(s) / 26,704
Nori Satoh unpublished cDNA library, tailbud embryo Nori Satoh unpublished cDNA library, tailbud embryo		103 clone(s) / 26,680
directional larval cDNA library directional larval cDNA library		0 clone(s) / 39
Ascidian hemocytes cDNA library Ascidian hemocytes cDNA library		0 clone(s) / 0
K. Inaba unpublished cDNA library, testis K. Inaba unpublished cDNA library, testis		0 clone(s) / 5,468
Stratagene UniZAP whole-larva library Stratagene UniZAP whole-larva library		0 clone(s) / 0
Ciona intestinalis larva Ciona intestinalis larva		0 clone(s) / 0
Nori Satoh unpublished cDNA library, blood cells Nori Satoh unpublished cDNA library, blood cells		0 clone(s) / 29,579
Nori Satoh unpublished cDNA library, endostyle Nori Satoh unpublished cDNA library, endostyle		0 clone(s) / 2,556
Nori Satoh unpublished cDNA library, cleaving embryo Nori Satoh unpublished cDNA library, cleaving embryo		11 clone(s) / 16,939
Nori Satoh unpublished cDNA library, gastrula and neurula Nori Satoh unpublished cDNA library, gastrula and neurula		21 clone(s) / 25,258
Nori Satoh unpublished cDNA library, gonad Nori Satoh unpublished cDNA library, gonad		0 clone(s) / 16,936
Nori Satoh unpublished cDNA library, neural complex Nori Satoh unpublished cDNA library, neural complex		0 clone(s) / 10,463
Nori Satoh unpublished cDNA library, heart Nori Satoh unpublished cDNA library, heart		0 clone(s) / 13,243
Yutaka Satou unpublished cDNA library, adult digestive gland Yutaka Satou unpublished cDNA library, adult digestive gland		0 clone(s) / 17,765
Yutaka Satou unpublished cDNA library, embryo whole animal Yutaka Satou unpublished cDNA library, embryo whole animal		83 clone(s) / 17,872
Yutaka Satou unpublished cDNA library, mature adult whole animal Yutaka Satou unpublished cDNA library, mature adult whole animal		5 clone(s) / 107,314
Nori Satoh unpublished cDNA library, juvenile whole animal Nori Satoh unpublished cDNA library, juvenile whole animal		42 clone(s) / 24,372
Nori Satoh unpublished cDNA library, mature adult whole animal Nori Satoh unpublished cDNA library, mature adult whole animal		0 clone(s) / 17,126
Ciona intestinalis whole animal stage3 juvenile Ciona intestinalis whole animal stage3 juvenile		15 clone(s) / 3,798
Yutaka Satou unpublished library (cicx) Yutaka Satou unpublished library (cicx)		0 clone(s) / 2,031
Gateway compatible cien cDNA library, Ciona intestinalis mixed embryonic stages (Egg to Neurula) Gateway compatible cien cDNA library, Ciona intestinalis mixed embryonic stages (Egg to Neurula)		20 clone(s) / 188,431

RNA-Seq transcriptome profiles (by Experiment)

3 results

OVERVIEW

Expression profile summary from all experiments in WT and mutant conditions:

FPKM & RPKM

Click here to see the RNA-Seq Pipeline Protocol.
You can show/hide lines in the charts by clicking on it in the legend part.
You can see more details by clicking on a point and then, on the link which will appear.

Be careful, FPKM & RPKM does not permit you to compare a gene across different conditions or experiments.

Download FPKM & RPKM data

OVERVIEW

Expression profile summary from all experiments in WT and mutant conditions:

Relative Log Expression RLE

Be careful, RLE and 2^RLE does not permit you to compare a gene across different experiments.

Download RLE Relative Log Expression data

RNA-Seq Experiment n°34135

Oocytes of a single individual of Ciona intestinalis (Roscoff, France) were fertilized by a mixture of sperm of two individuals and development was followed microscopically. Embryos were snapfrozen in liquid nitrogen at the appropriate stage and kept at -80°C. Samples at stage 0, 8, 12, 15, 21, 26 were collected from the same fertilzation, while sample from stage 11 was independently collected from a different individual. Total RNA was prepared with the RNA II kit of Magerey Nagel and the quality was checked with the Bioanalyzer, all samples had a RIN value of higher than 9. Strand specific libraries were constructed and the sequencing (50PE) was performed with Illumina HiSeq 2000 technology (BGI, Hong Kong, China). Reads were aligned onto C.robusta genome and considered to reflect the expression of the C.robusta orthologous genes.

Assay platform	Illumina HiSeq 2000
Layout	Paired-end
Stranded	Yes
Read length	49
Normalized data types	FPKM RLE
Wild type - Replica 1
	*Territories*	whole embryo -

	*Biomaterial(s)*	C. robusta formely Ciona int. type A, Stage 0 (Unfertilized egg)
		C. robusta formely Ciona int. type A, Stage 8 (64-cell)
		C. robusta formely Ciona int. type A, Stage 11 (early gastrula)
		C. robusta formely Ciona int. type A, Stage 12 (mid gastrula)
		C. robusta formely Ciona int. type A, Stage 15 (mid neurula)
		C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)
		C. robusta formely Ciona int. type A, Stage 26 (hatching larva)

Wild type - Replica 2
	*Territories*	whole embryo -

	*Biomaterial(s)*	C. robusta formely Ciona int. type A, Stage 0 (Unfertilized egg)
		C. robusta formely Ciona int. type A, Stage 8 (64-cell)
		C. robusta formely Ciona int. type A, Stage 11 (early gastrula)
		C. robusta formely Ciona int. type A, Stage 12 (mid gastrula)
		C. robusta formely Ciona int. type A, Stage 15 (mid neurula)
		C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)
		C. robusta formely Ciona int. type A, Stage 26 (hatching larva)

RNA-Seq Experiment n°34138

Ciona robusta adults were obtained from the National Bio-Resource Project for Ciona (NBRP, Japan). 50 unperturbed and Foxd-morphant embryos were collected at the 32-, 64-, and 112-cell stages. RNA was extracted using a Dynabeads mRNA DIRECT Purification Kit (Thermo Fischer Scientific) and libraries were made with an Ion Total RNA-Seq kit ver 2 (Thermo Fischer Scientific). The libraries were sequenced with an Ion PGM instrument (Thermo Fischer Scientific).

Assay platform	Ion Torrent PGM
Layout	Single-end
Stranded	Yes
Read length	20-365
Normalized data types	RPKM
Wild type
	*Territories*	whole embryo -

	*Biomaterial(s)*	C. robusta formely Ciona int. type A, Stage 6a (early 32-cell)
		C. robusta formely Ciona int. type A, Stage 8 (64-cell)
		C. robusta formely Ciona int. type A, Stage 10 (112-cell)

Mutant
	*Deregulated molecule(s)*	KH2012:KH.C8.890 -
	*Territories*	whole embryo -
	*Biomaterial(s)*	C. robusta formely Ciona int. type A, Stage 6a (early 32-cell)
		C. robusta formely Ciona int. type A, Stage 8 (64-cell)
		C. robusta formely Ciona int. type A, Stage 10 (112-cell)

RNA-Seq Experiment n°34139

The purpose of this project is to identify genes positively and negatively regulated by signaling molecules that belongs to the TGFbeta superfamily.

Assay platform	Illumina HiSeq 2500
Layout	Single-end
Stranded	Yes
Read length	101
Normalized data types	RPKM
Wild type
	*Territories*	whole embryo -

	*Biomaterial(s)*	C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Mutant 1
	*Deregulated molecule(s)*	KH2012:KH.C4.125 -
	*Territories*	whole embryo -
	*Biomaterial(s)*	C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

Mutant 2
	*Deregulated molecule(s)*	KH2012:KH.C2.573 -
	*Territories*	whole embryo -
	*Biomaterial(s)*	C. robusta formely Ciona int. type A, Stage 13 (late gastrula)

In Situ Experiment Data

47 results

Click here to visualize with MorphoNet

Experiment data ( results)

C. robusta formely Ciona int. type A, Stage 14 (early neurula)

The control picture shows the expression of Epi-1 in uninjected sibbling caps.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 14 (early neurula)

View of neurula stage animal cap explants dissected at 8-cell stage, injected with FGF9/16/20 mRNA (AB086097) before fertilization and stained by ISH with the epidermal Epi-1 marker (AB037395). Injected FGF9/16/20 mRNA blocks Epi-1 expression. The control picture shows the expression of Epi-1 in uninjected sibbling caps.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	No expression -

C. robusta formely Ciona int. type A, Stage 14 (early neurula)

View of a neurula stage embryo, cleavage arrested from the 64-cell stage, and stained by ISH with a probe for the epidermis marker Epi1. The a-line neural plate cells are marked with red dots. The epidermis is stained.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 14 (early neurula)

View of an embryo injected with FGF9-MO morpholino (TTGAGTTTGTAGACTGTTGCTGCTG) before fertilisation, cleavage arrested from the 64-cell stage, fixed at the neurula stage and stained by ISH with a probe for the epidermis marker Epi1. All animal cells including the a-line neural plate progenitors, marked with red dots, are converted to epidermis. The control picture shows the expression pattern of Epi1 in sibbling uninjected embryos.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	a line neural plate - epidermis -

C. robusta formely Ciona int. type A, Stage 14 (early neurula)

View of neurula stage animal cap explants dissected at 8-cell stage, and stained for Epi-1 mRNA (AB037395).

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	a line neural plate - b line neural plate - epidermis -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Batch of WT Ciona robusta neurula stage embryos probed for Epi-1 expression.
Epi-1 is expressed in the ectoderm lineage.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	ectoderm primordia -

Batch of control Ciona robusta neurula stage embryos probed for Epi-1 expression and electroporated with the reporter construct pFT>Tomato.
Epi-1 is expressed in the ectoderm lineage.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	ectoderm primordia -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Batch of WT Ciona robusta neurula stage embryos probed for Epi-1 expression.
Epi-1 is expressed in the ectoderm lineage.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	ectoderm primordia -

Batch of control Ciona robusta neurula stage embryos probed for Epi-1 expression and electroporated with the reporter construct pFT>Tomato.
Epi-1 is expressed in the ectoderm lineage.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	ectoderm primordia -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Batch of Ciona robusta neurula stage embryos probed for Epi-1 expression and co-electroporated with pFT>Foxa.a, pFT>Foxd and pFT>Fgf9/16/20. The upstream regulatory sequences of the Fucosyltransferase-like (FT) is active in ectoderm cells from the 64-cell stage.
Epi-1 expression in the ectoderm lineage is strongly reduced.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	ectoderm primordia -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Expression of the epidermis markers epi1 in control embryos. Embryos were cleavage-arrested at the 64-cell stage with cytochalasin and stained at the equivalent of the neurula stage for the presence of epi1 transcripts.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 15 (mid neurula)

Expression of the epidermis markers epi1 in EnR-GATAa mRNA injected embryos. EnR-GATAa mRNA is a repressive version of GATAa. Embryos were cleavage-arrested at the 64-cell stage with cytochalasin and stained at the equivalent of the neurula stage for the presence of epi1 transcripts. EnR-GATAa-injected embryos had severely reduced expression of both epidermal markers.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 16 (late neurula)

Dorsal view of a late neurula showing Epi1 expression throughout the epidermis. The cleavage arrested embryo (from 64-cell stage) confirms that the a-line neural precursors (red) do not express Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 16 (late neurula)

Dorsal view of a late neurula treated with PD184352 from the 8-cell stage and showing Epi1 expression throughout the epidermis and a-line neural plate(note the change in shape of the embryo due to gastrulation problems). The cleavage arrested embryo (from 64-cell stage) confirms that the a-line neural precursors (red) do express Epi1 when MEK signalling is inhibited.

Controls: Dorsal view of a late neurula showing Epi1 expression throughout the epidermis. The cleavage arrested embryo (from 64-cell stage) confirms that the a-line neural precursors (red) do not express Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	a line neural plate - epidermis -

C. robusta formely Ciona int. type A, Stage 17 (initial tailbud I)

Conversion to Aniseed format of Ghost database entry from Satou Y et al., Development 2001; 128:2893-2904. Original annotation: . Expression pattern: Epidermis

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Conversion to Aniseed format of Ghost database entry from Satou Y et al., Development 2001; 128:2893-2904. Original annotation: . Expression pattern: Epidermis

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Expression of the epidermis markers epi1 in early tailbud embryos.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 19 (early tailbud I)

Expression of the epidermis markers epi1 in EnR-GATAa mRNA-injected embryos (EnR-GATAa mRNA is a repressive version of GATAa).

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	No expression -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Conversion to Aniseed format of Ghost database entry from Satou Y et al., Development 2001; 128:2893-2904. Original annotation: . Expression pattern: Epidermis

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Lateral view of a mid tailbud wild type stage embryo probed for Ci-Epi1 expression.

Ci-Epi1 was expressed in all epidermis.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Mid tailbud embryos probed for Ci-Epi1 expression following the injection of Ci-Rga-MO and Ci-Rga mRNA lacking the target site of the morpholino.

Original Annotation :
The expression of markers for the epidermis was detected in all cases, showing that defects caused by Ci- Rga knock-down were attenuated by Ci-RgamMO mRNA overexpression.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Mid tailbud embryos probed for Ci-Epi1 expression following the injection of Ci-Rga-MO.

Original Annotation : The expression of a marker for epidermis, Ci-Epi1, was hardly detectable in four (40%) of 10 knock-down embryos that showed the amorphous cell aggregate phenotype.
An arrow in (L) indicates reduced expression of Ci-Epi1.
First picture : Ci-Rga knock-down embryos with a weaker phenotype that develop into embryos covered by an epidermis layer.
Second picture : Ci-Rga knock-down embryos with severe phenotype that develop into cell aggregates.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Lateral view of a mid tailbud stage embryo probed with ci-Epi1 expression.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Lateral view of a mid tailbud stage embryo probed with Epi1 (epidermis) expression. Expression of tissue-specific differenciation markers in morpholino oligonucleotide-injected embryos at the stage corresponding to the mid tailbud stage. Embryos injected with MO against cieg007f18.

Original annotation: in the cieg007f18 knockdown embryos, whole-mount in situ hybridization showed that epidermis was reduced.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Lateral view of a mid tailbud stage embryo probed with Ci-Epi1 (epidermis) expression. Expression of tissue-specific differenciation markers in morpholino oligonucleotide-injected embryos at the stage corresponding to the mid tailbud stage.

Original annotation Embryos injected with MO against cilv006h21 as classified as " ball" phenotype: they developped into spherical-shaped cell masses, like balls. In these embryos, detection of the tissue specific markers indicated thaht almost the major tissues were lost or reduced.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Original annotation Embryos injected with MO against cieg028g04 as classified as " irregular" phenotype: embryos formed an irregular cellular mass. The a/p axis and trunk and tail could not be distinguished.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Original annotation: Embryos injected with MO against cieg009p15 as classified as " irregular" phenotype: embryos formed an irregular cellular mass. The a/p axis and trunk and tail could not be distinguished.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Original annotation: Embryos injected with MO against cieg039g16 is classified as " a/p axis" phenotype: embryos were extended along the anterior-posterior (a/p) axis, but did not form normal tadpoles, with head and tail being indistinguishable.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Original annotation: Embryos injected with MO against cicl017h21 is classified as " a/p axis" phenotype: embryos were extended along the anterior-posterior (a/p) axis, but did not form normal tadpoles, with head and tail being indistinguishable.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Original annotation: Embryos injected with MO against cieg010p13 is classified as " a/p axis" phenotype: embryos were extended along the anterior-posterior (a/p) axis, but did not form normal tadpoles, with head and tail being indistinguishable.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Original annotation: Embryos injected with MO against ciad033i21 is classified as " flat" phenotype: eggs develop into flattened larvae and they lost the expression of markers for endoderm, notochord and mesenchyme.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Lateral view of a mid tailbud stage embryo, showing expression of Ci-Epi1 on epidermis.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Lateral view of mid tailbud stage embryo, injected with Ci-C10orf11 MO. Effects of functional suppression of Ci-C10orf11 on differentiation of epidermis. Differentiation of epidermis was assessed by expression of Ci-Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Lateral view of mid tailbud stage embryo, injected with Ci-PGAP1 MO. Effects of functional suppression of Ci-PGAP1 on differentiation of epidermis. Differentiation of epidermis was assessed by expression of Ci-Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Lateral view of mid tailbud stage embryo, injected with Ci-ZF278 MO. Effects of functional suppression of Ci-ZF278 on differentiation of epidermis. Differentiation of epidermis was assessed by expression of Ci-Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Lateral view of mid tailbud stage embryo, injected with Ci-Spatial MO. Effects of functional suppression of Ci-Spatial on differentiation of epidermis. Differentiation of epidermis was assessed by expression of Ci-Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Lateral view of mid tailbud stage embryo, injected with Ci-FLJ10634 MO. Effects of functional suppression of Ci-FLJ10634 on differentiation of epidermis. Differentiation of epidermis was assessed by expression of Ci-Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Lateral view of mid tailbud stage embryo, injected with Ci-Beta Catenin MO. Effects of functional suppression of Ci-Beta Catenin on differentiation of epidermis. Differentiation of epidermis was assessed by expression of Ci-Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

View of a mid tailbud stage embryo, showing expression of Ci-Epi1 in epidermis. Embryos were treated with cytochalasin B from the 110-cell stage.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Effects of functional suppression of Ci-C10orf11 with specific morpholino on differentiation of epidermis in the cleavage-arrested embryos. Eggs were injected with morpholino against Ci-C10orf11 and treated with cytochalasin B from the 110-cell stage. Differentiation of epidermis was assessed by expression of Ci-Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Effects of functional suppression of Ci-PGAP1 with specific morpholino on differentiation of epidermis in the cleavage-arrested embryos. Eggs were injected with morpholino against Ci-PGAP1 and treated with cytochalasin B from the 110-cell stage. Differentiation of epidermis was assessed by expression of Ci-Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Effects of functional suppression of Ci-ZF278 with specific morpholino on differentiation of epidermis in the cleavage-arrested embryos. Eggs were injected with morpholino against Ci-ZF278 and treated with cytochalasin B from the 110-cell stage. Differentiation of epidermis was assessed by expression of Ci-Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Effects of functional suppression of Ci-spatial with specific morpholino on differentiation of epidermis in the cleavage-arrested embryos. Eggs were injected with morpholino against Ci-spatial and treated with cytochalasin B from the 110-cell stage. Differentiation of epidermis was assessed by expression of Ci-Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Effects of functional suppression of Ci-FLJ10634 with specific morpholino on differentiation of epidermis in the cleavage-arrested embryos. Eggs were injected with morpholino against Ci-FLJ10634 and treated with cytochalasin B from the 110-cell stage. Differentiation of epidermis was assessed by expression of Ci-Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 21 (mid tailbud I)

Effects of functional suppression of Ci-Beta Catenin with specific morpholino on differentiation of epidermis in the cleavage-arrested embryos. Eggs were injected with morpholino against Ci-Beta Catenin and treated with cytochalasin B from the 110-cell stage. Differentiation of epidermis was assessed by expression of Ci-Epi1.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Late tailbud stage wild type embryo probed for Ci-Epi1 expression. We can see expression in epidermal cells.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Conversion to Aniseed format of Ghost database entry from Satou Y et al., Development 2001; 128:2893-2904. Original annotation: . Expression pattern: Epidermis

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 23 (late tailbud I)

Late tailbud stage embryo probed for Ci-EPi1 expression following egg micro-injection of a cieg003h01-MO.

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -

C. robusta formely Ciona int. type A, Stage 26 (hatching larva)

Conversion to Aniseed format of Ghost database entry from Kusakabe T et al., Dev Biol. 2002; 242:188-203. Original annotation: . Expression pattern: Epidermis

Stained molecule	KH2012:KH.C1.188 (TFF1)
Stained region(s)	epidermis -